Incidental Mutation 'R5044:Epha3'
ID394282
Institutional Source Beutler Lab
Gene Symbol Epha3
Ensembl Gene ENSMUSG00000052504
Gene NameEph receptor A3
SynonymsTyro4, End3, Cek4, Hek, Hek4, Mek4
MMRRC Submission 042634-MU
Accession Numbers

Genbank: NM_010140; MGI: 99612

Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R5044 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location63543534-63864175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63602287 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 580 (K580R)
Ref Sequence ENSEMBL: ENSMUSP00000066554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064405] [ENSMUST00000232049]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064405
AA Change: K580R

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066554
Gene: ENSMUSG00000052504
AA Change: K580R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EPH_lbd 29 202 1.76e-127 SMART
Pfam:GCC2_GCC3 263 306 6.6e-9 PFAM
FN3 326 418 1.14e-5 SMART
FN3 437 518 4.8e-13 SMART
Pfam:EphA2_TM 543 619 8.2e-25 PFAM
TyrKc 622 879 5.16e-140 SMART
SAM 909 976 1.08e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232049
AA Change: K579R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0873 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 48 hours of birth of cardiac failure. Survivors develop normally with no indications of cardiac abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Chrna9 T C 5: 65,971,016 L189P probably damaging Het
Clca1 A C 3: 145,007,928 probably null Het
Cntn1 G T 15: 92,242,995 V201F probably damaging Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Ddhd2 T C 8: 25,752,137 Y237C probably damaging Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Fam135b T C 15: 71,462,711 N878S probably benign Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Hipk2 G A 6: 38,818,879 P152S probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Muc19 C T 15: 91,888,138 noncoding transcript Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtkn T A 6: 83,150,991 D377E probably benign Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Setd1b T A 5: 123,151,866 I632N unknown Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Srpk2 A T 5: 23,524,392 D416E possibly damaging Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp4 T C 2: 121,173,580 L34P probably damaging Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Unc79 T A 12: 103,112,703 V1690E probably benign Het
Vps4b T C 1: 106,796,418 probably null Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Epha3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Epha3 APN 16 63566684 missense probably damaging 1.00
IGL01358:Epha3 APN 16 63595746 splice site probably benign
IGL01713:Epha3 APN 16 63552562 missense probably benign 0.00
IGL02371:Epha3 APN 16 63585020 critical splice acceptor site probably null
IGL03111:Epha3 APN 16 63653446 missense probably damaging 0.98
IGL03208:Epha3 APN 16 63611089 missense probably damaging 1.00
laterality UTSW 16 63568399 missense probably damaging 1.00
midline UTSW 16 63844144 missense possibly damaging 0.46
stride UTSW 16 63552494 missense probably benign 0.00
F2404:Epha3 UTSW 16 63546168 missense probably benign 0.14
P0041:Epha3 UTSW 16 63612868 missense probably damaging 1.00
PIT4498001:Epha3 UTSW 16 63552526 missense probably damaging 1.00
PIT4585001:Epha3 UTSW 16 63566577 critical splice donor site probably null
R0147:Epha3 UTSW 16 63612944 missense possibly damaging 0.89
R0148:Epha3 UTSW 16 63612944 missense possibly damaging 0.89
R0336:Epha3 UTSW 16 63566648 missense probably damaging 1.00
R0738:Epha3 UTSW 16 63595612 missense probably damaging 1.00
R0833:Epha3 UTSW 16 63603519 splice site probably benign
R0836:Epha3 UTSW 16 63603519 splice site probably benign
R0969:Epha3 UTSW 16 63566636 missense probably damaging 1.00
R1160:Epha3 UTSW 16 63773068 missense probably damaging 1.00
R1205:Epha3 UTSW 16 63598248 frame shift probably null
R1349:Epha3 UTSW 16 63611053 missense possibly damaging 0.89
R1372:Epha3 UTSW 16 63611053 missense possibly damaging 0.89
R1469:Epha3 UTSW 16 63653494 missense probably damaging 0.97
R1469:Epha3 UTSW 16 63653494 missense probably damaging 0.97
R1500:Epha3 UTSW 16 63595662 missense probably benign 0.06
R1523:Epha3 UTSW 16 63610948 missense probably damaging 0.99
R1532:Epha3 UTSW 16 63546178 missense probably benign 0.08
R1544:Epha3 UTSW 16 63773053 missense probably damaging 1.00
R1681:Epha3 UTSW 16 63595728 missense probably damaging 1.00
R1708:Epha3 UTSW 16 63583507 missense probably damaging 1.00
R1803:Epha3 UTSW 16 63602288 missense probably benign 0.00
R1893:Epha3 UTSW 16 63568399 missense probably damaging 1.00
R1957:Epha3 UTSW 16 63772952 missense probably benign 0.00
R2144:Epha3 UTSW 16 63773317 missense possibly damaging 0.86
R2190:Epha3 UTSW 16 63546189 missense probably benign 0.05
R2198:Epha3 UTSW 16 63844144 missense possibly damaging 0.46
R2344:Epha3 UTSW 16 63652383 missense possibly damaging 0.67
R2504:Epha3 UTSW 16 63603625 missense probably damaging 0.97
R2911:Epha3 UTSW 16 63652412 missense probably benign
R3889:Epha3 UTSW 16 63610964 missense probably damaging 1.00
R4223:Epha3 UTSW 16 63583539 missense probably damaging 0.99
R4836:Epha3 UTSW 16 63583557 missense probably damaging 1.00
R4981:Epha3 UTSW 16 63652412 missense probably benign 0.04
R5195:Epha3 UTSW 16 63546147 missense possibly damaging 0.86
R5248:Epha3 UTSW 16 63598257 missense probably damaging 1.00
R5478:Epha3 UTSW 16 63583533 missense probably damaging 1.00
R6052:Epha3 UTSW 16 63603604 missense possibly damaging 0.94
R6167:Epha3 UTSW 16 63612924 missense probably benign 0.00
R6337:Epha3 UTSW 16 63568443 missense probably damaging 1.00
R6342:Epha3 UTSW 16 63583500 missense probably damaging 1.00
R6793:Epha3 UTSW 16 63773455 missense probably benign 0.01
R6908:Epha3 UTSW 16 63598249 missense probably damaging 1.00
R7029:Epha3 UTSW 16 63773335 missense probably benign 0.37
R7059:Epha3 UTSW 16 63568455 missense probably damaging 1.00
R7175:Epha3 UTSW 16 63583500 missense probably damaging 1.00
R7204:Epha3 UTSW 16 63652332 missense probably benign
R7217:Epha3 UTSW 16 63552494 missense probably benign 0.00
R7315:Epha3 UTSW 16 63552609 missense probably benign 0.00
R7389:Epha3 UTSW 16 63772984 missense probably damaging 1.00
R7419:Epha3 UTSW 16 63598294 missense probably damaging 1.00
R7572:Epha3 UTSW 16 63611080 nonsense probably null
R7667:Epha3 UTSW 16 63566600 missense probably benign 0.21
R7686:Epha3 UTSW 16 63773288 missense probably damaging 1.00
R7855:Epha3 UTSW 16 63773560 missense probably damaging 1.00
R7938:Epha3 UTSW 16 63773560 missense probably damaging 1.00
Z1176:Epha3 UTSW 16 63585012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGAAACACCTCCATGGAG -3'
(R):5'- CATTAGGCAACCTTCCAGGGTAC -3'

Sequencing Primer
(F):5'- CACCTCCATGGAGAAAACATTTC -3'
(R):5'- TTCAGGGGAAAGCTTGAG -3'
Posted On2016-06-15