Mutagenetix > Incidental Mutation

Incidental Mutation 'R5150:Olfr1474'

395325

Institutional Source

Beutler Lab

Gene Symbol

Olfr1474

Ensembl Gene

ENSMUSG00000096273

Gene Name

olfactory receptor 1474

Synonyms

MOR202-42, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527

Accession Numbers

Genbank: NM_001011842.1

Essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R5150 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13469565-13472157 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 13471430 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 153 (Q153H)

Ref Sequence

ENSEMBL: ENSMUSP00000151810 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096202] [ENSMUST00000207529] [ENSMUST00000220113]

AlphaFold

Q7TQQ8

Predicted Effect

probably benign
Transcript: ENSMUST00000096202
AA Change: Q153H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000093916
Gene: ENSMUSG00000096273
AA Change: Q153H

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	306	1.6e-52	PFAM
Pfam:7TM_GPCR_Srsx	33	303	1e-7	PFAM
Pfam:7tm_1	39	288	8.7e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000207529
AA Change: Q111H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

probably benign
Transcript: ENSMUST00000220113
AA Change: Q153H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

93% (57/61)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

none

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	A	G	4: 35,193,270	S228P	possibly damaging	Het
9930021J03Rik	C	A	19: 29,805,550	A109S	probably damaging	Het
Adam33	T	C	2: 131,053,197		probably benign	Het
Ahnak	T	C	19: 9,010,904	V3184A	possibly damaging	Het
Aoc1	A	G	6: 48,906,150	N320S	possibly damaging	Het
Bin2	T	C	15: 100,645,363	E313G	probably damaging	Het
Ccdc47	T	C	11: 106,205,439	D253G	possibly damaging	Het
Ccdc73	A	G	2: 104,992,039	T778A	probably benign	Het
Cops3	C	A	11: 59,820,013	D377Y	probably damaging	Het
Cyp4a14	A	C	4: 115,493,609	V156G	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Disp1	C	A	1: 183,089,499	M452I	probably damaging	Het
Fam210b	T	C	2: 172,351,548	Y94H	probably damaging	Het
Fbxo45	C	A	16: 32,246,706		probably benign	Het
Flrt2	T	A	12: 95,779,203	M105K	possibly damaging	Het
Gm26558	G	A	2: 70,661,312		probably benign	Het
Gpr83	T	G	9: 14,860,805	L91R	probably damaging	Het
Greb1l	TTTAATAACTT	TTT	18: 10,555,950		probably null	Het
Hmces	T	A	6: 87,933,235		probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Ksr2	A	C	5: 117,555,009	E174A	probably damaging	Het
Lats1	A	G	10: 7,712,651	T1011A	probably benign	Het
Lrrc46	T	C	11: 97,036,131	D120G	probably damaging	Het
Ncstn	C	A	1: 172,067,584		probably benign	Het
Neb	T	C	2: 52,169,118	T6118A	probably benign	Het
Nipsnap2	A	C	5: 129,757,111	M272L	probably benign	Het
Nlgn2	C	T	11: 69,825,390	R775H	probably damaging	Het
Olfr1284	T	A	2: 111,379,253	D84E	probably damaging	Het
Olfr1309	T	A	2: 111,984,021	T18S	probably benign	Het
Olfr1314	T	A	2: 112,092,535	L55F	possibly damaging	Het
Olfr135	A	C	17: 38,208,317	E24A	possibly damaging	Het
Olfr157	A	G	4: 43,836,301	L63P	probably damaging	Het
Pold1	A	G	7: 44,535,832	V750A	possibly damaging	Het
Prdm11	C	T	2: 92,975,472	E378K	probably damaging	Het
Ptpn9	A	G	9: 57,036,670	D276G	probably benign	Het
Rlf	A	T	4: 121,148,172	F1204I	probably damaging	Het
Robo1	C	A	16: 72,972,304	T537K	possibly damaging	Het
Sec31b	T	A	19: 44,520,531	M670L	probably benign	Het
Sephs1	T	A	2: 4,899,510	V233E	possibly damaging	Het
Serpinb2	T	C	1: 107,523,209		probably null	Het
Sf3b3	T	C	8: 110,823,376	Q670R	possibly damaging	Het
Slc8a2	A	C	7: 16,145,176	D529A	possibly damaging	Het
Sva	A	G	6: 42,042,159	N88D	probably benign	Het
Tcf15	G	T	2: 152,144,131	R169L	probably damaging	Het
Tfr2	A	G	5: 137,574,490	T188A	probably benign	Het
Tshz1	T	A	18: 84,013,215	K1023*	probably null	Het
Ttc28	A	G	5: 111,225,689	N966S	probably damaging	Het
Unc5c	T	A	3: 141,757,793	I225N	probably damaging	Het
Ush2a	T	C	1: 188,451,870	L1457S	possibly damaging	Het
Zbtb34	G	T	2: 33,411,121	H469Q	probably damaging	Het
Zfp692	T	C	11: 58,307,587	M1T	probably null	Het

Other mutations in Olfr1474

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03256:Olfr1474	APN	19	13471267	missense	probably damaging	0.99
D605:Olfr1474	UTSW	19	13471157	nonsense	probably null
R0173:Olfr1474	UTSW	19	13471701	missense	probably benign	0.02
R1102:Olfr1474	UTSW	19	13471407	missense	probably damaging	0.97
R1515:Olfr1474	UTSW	19	13471680	missense	probably damaging	0.97
R1780:Olfr1474	UTSW	19	13471362	missense	probably benign	0.14
R2061:Olfr1474	UTSW	19	13471241	missense	probably damaging	0.98
R4016:Olfr1474	UTSW	19	13471197	missense	possibly damaging	0.95
R4485:Olfr1474	UTSW	19	13471555	missense	probably benign	0.08
R5119:Olfr1474	UTSW	19	13471546	missense	probably benign	0.00
R5156:Olfr1474	UTSW	19	13471673	missense	probably damaging	1.00
R5699:Olfr1474	UTSW	19	13470972	start codon destroyed	probably null	0.78
R5800:Olfr1474	UTSW	19	13471896	missense	probably benign	0.06
R5840:Olfr1474	UTSW	19	13471878	missense	probably benign	0.01
R5953:Olfr1474	UTSW	19	13471368	missense	possibly damaging	0.92
R5997:Olfr1474	UTSW	19	13471506	missense	probably benign	0.12
R6233:Olfr1474	UTSW	19	13471740	missense	probably damaging	1.00
R6488:Olfr1474	UTSW	19	13471617	missense	probably damaging	1.00
R6847:Olfr1474	UTSW	19	13471038	missense	probably benign	0.03
R6964:Olfr1474	UTSW	19	13471361	nonsense	probably null
R7214:Olfr1474	UTSW	19	13470973	start codon destroyed	probably null	1.00
R8001:Olfr1474	UTSW	19	13471422	missense	probably benign	0.03
R8035:Olfr1474	UTSW	19	13471899	missense	probably benign
R8129:Olfr1474	UTSW	19	13471144	missense	probably damaging	1.00
R9018:Olfr1474	UTSW	19	13471357	missense	possibly damaging	0.60
R9061:Olfr1474	UTSW	19	13471159	missense	probably damaging	0.98
R9065:Olfr1474	UTSW	19	13471306	missense	probably damaging	0.97
R9373:Olfr1474	UTSW	19	13471852	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTAAATGGGTGTGCTGCC -3'
(R):5'- CGCATCCTCAGGATAGCAATG -3'

Sequencing Primer
(F):5'- TGTGCTGCCCAGATGTTC -3'
(R):5'- TCCTCAGGATAGCAATGAAAATAAGC -3'

Posted On

2016-06-21