Incidental Mutation 'R5162:Adrb3'
ID397057
Institutional Source Beutler Lab
Gene Symbol Adrb3
Ensembl Gene ENSMUSG00000031489
Gene Nameadrenergic receptor, beta 3
SynonymsAdrb-3, Beta-3 AR, Beta-3 adrenoceptor, beta3-adrenergic receptor, beta 3-AR
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location27225776-27250616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27227320 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 367 (E367G)
Ref Sequence ENSEMBL: ENSMUSP00000113006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081438] [ENSMUST00000117565] [ENSMUST00000121838] [ENSMUST00000209299]
Predicted Effect probably benign
Transcript: ENSMUST00000081438
AA Change: E367G

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080162
Gene: ENSMUSG00000031489
AA Change: E367G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 43 240 1.1e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 357 2.3e-14 PFAM
Pfam:7tm_1 51 343 9.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117565
AA Change: E367G

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113732
Gene: ENSMUSG00000031489
AA Change: E367G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 43 240 1.8e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 357 2.4e-14 PFAM
Pfam:7tm_1 51 343 4.9e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121838
AA Change: E367G

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113006
Gene: ENSMUSG00000031489
AA Change: E367G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 43 240 1.1e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 357 2.3e-14 PFAM
Pfam:7tm_1 51 343 9.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211346
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of beta adrenergic receptors, which mediate catecholamine-induced activation of adenylate cyclase through the action of G proteins. This receptor is located mainly in the adipose tissue and is involved in the regulation of lipolysis and thermogenesis. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for targeted null mutations develop greater adiposity, especially on a high-fat diet, and are unresponsive to the beta3-adrenergic receptor agonist, CL316,243. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Adrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0639:Adrb3 UTSW 8 27228265 missense probably damaging 0.97
R0786:Adrb3 UTSW 8 27226852 unclassified probably benign
R1370:Adrb3 UTSW 8 27227770 unclassified probably null
R1449:Adrb3 UTSW 8 27227387 missense probably damaging 1.00
R1874:Adrb3 UTSW 8 27227563 missense probably damaging 1.00
R3426:Adrb3 UTSW 8 27228181 missense probably damaging 1.00
R3428:Adrb3 UTSW 8 27228181 missense probably damaging 1.00
R4941:Adrb3 UTSW 8 27227422 missense probably damaging 1.00
R4989:Adrb3 UTSW 8 27227770 missense probably damaging 1.00
R4994:Adrb3 UTSW 8 27227827 unclassified probably null
R5133:Adrb3 UTSW 8 27227770 missense probably damaging 1.00
R5134:Adrb3 UTSW 8 27227770 missense probably damaging 1.00
R5342:Adrb3 UTSW 8 27226781 nonsense probably null
R5656:Adrb3 UTSW 8 27227377 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGCCCGTTTTAGTTCCTAC -3'
(R):5'- CGCACCTTAGGTCTCATTATGG -3'

Sequencing Primer
(F):5'- TTCTGTCCTCTCAAGACAAAGG -3'
(R):5'- ACCTTAGGTCTCATTATGGGCATC -3'
Posted On2016-06-21