Mutagenetix > Incidental Mutation

Incidental Mutation 'R5162:Sptlc3'

397036

Institutional Source

Beutler Lab

Gene Symbol

Sptlc3

Ensembl Gene

ENSMUSG00000039092

Gene Name

serine palmitoyltransferase, long chain base subunit 3

Synonyms

MMRRC Submission

042744-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R5162 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139493913-139637674 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139631343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 504 (M504K)

Ref Sequence

ENSEMBL: ENSMUSP00000105710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047370] [ENSMUST00000110083]

AlphaFold

Q8BG54

Predicted Effect

probably benign
Transcript: ENSMUST00000047370
AA Change: M504K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000048313
Gene: ENSMUSG00000039092
AA Change: M504K

Domain	Start	End	E-Value	Type
transmembrane domain	60	79	N/A	INTRINSIC
Pfam:Aminotran_1_2	160	520	4.8e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110083
AA Change: M504K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000105710
Gene: ENSMUSG00000039092
AA Change: M504K

Domain	Start	End	E-Value	Type
transmembrane domain	60	79	N/A	INTRINSIC
Pfam:Aminotran_1_2	160	520	4.8e-59	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134801

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SPTLC3 gene encodes an isoform of the third subunit of serine palmitoyltransferase (SPT; EC 2.3.1.50), which catalyzes the rate-limiting step of the de novo synthesis of sphingolipids (Hornemann et al., 2006 [PubMed 17023427]). SPT contains 2 main subunits: the common SPTLC1 subunit (MIM 605712) and either SPTLC2 (MIM 605713) or its isoform SPTLC2L (SPTLC3), depending on the tissue in which biosynthesis occurs (Hornemann et al., 2006 [PubMed 17023427]). There are also 2 highly related isoforms of a third subunit, SSSPTA (MIM 613540) and SSSPTB (MIM 610412), that confer acyl-CoA preference of the SPT enzyme and are essential for maximal enzyme activity (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	A	9: 124,293,671	T229S	probably benign	Het
Adrb3	T	C	8: 27,227,320	E367G	probably benign	Het
Ak9	T	A	10: 41,357,657	N630K	probably damaging	Het
Atp8b1	T	C	18: 64,561,662	I516M	possibly damaging	Het
Bcor	C	T	X: 12,040,486	R1551Q	probably damaging	Het
Cry1	T	A	10: 85,133,286	H558L	probably benign	Het
Cyp3a57	T	A	5: 145,369,083	W126R	probably damaging	Het
Dhx36	A	T	3: 62,493,780	V355E	probably damaging	Het
Diexf	G	T	1: 193,113,781	T192K	probably damaging	Het
Dpp6	A	G	5: 27,399,015		probably benign	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Enpp2	T	C	15: 54,847,296	D694G	probably benign	Het
Esrp2	T	C	8: 106,133,298	E336G	probably damaging	Het
Faah	A	T	4: 116,000,741		probably benign	Het
Fat1	G	A	8: 45,025,809	G2608R	probably benign	Het
Fbxo8	A	T	8: 56,569,319	Y122F	probably damaging	Het
Fgd5	A	G	6: 92,074,234	D1497G	probably damaging	Het
Fn3krp	T	C	11: 121,429,584	F252L	probably damaging	Het
Fnip2	T	C	3: 79,481,777	Y549C	probably damaging	Het
Gcm2	T	C	13: 41,103,655	N206S	probably benign	Het
Gm4758	A	T	16: 36,312,556	H65L	probably damaging	Het
Grn	C	A	11: 102,430,554		probably benign	Het
H2-T10	T	A	17: 36,118,951		probably null	Het
Henmt1	T	C	3: 108,940,050		probably null	Het
Man1b1	T	A	2: 25,343,353	L246Q	probably damaging	Het
Mdh2	T	C	5: 135,783,475		probably null	Het
Mocos	T	C	18: 24,654,052	F43L	probably damaging	Het
Mpp6	T	A	6: 50,178,515	W259R	probably damaging	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Naip5	T	A	13: 100,223,406	I441F	possibly damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nars2	T	C	7: 97,059,820		probably benign	Het
Ncoa2	A	T	1: 13,175,172	M434K	possibly damaging	Het
Nlrp4g	T	A	9: 124,350,394		noncoding transcript	Het
Olfr459	G	T	6: 41,771,772	H176N	possibly damaging	Het
Olfr761	T	A	17: 37,952,364	Q220L	probably benign	Het
Pars2	A	G	4: 106,654,538	T506A	probably benign	Het
Pkp2	T	C	16: 16,260,336	S481P	probably damaging	Het
Plod3	T	C	5: 136,991,307	W459R	probably damaging	Het
Pramef12	A	T	4: 144,394,912	L181M	probably damaging	Het
Prdm10	A	T	9: 31,340,418	I361F	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Raver2	T	C	4: 101,102,724	C134R	probably damaging	Het
Rnf130	G	C	11: 50,052,895	A123P	probably damaging	Het
Slc29a4	G	A	5: 142,721,452	A517T	possibly damaging	Het
Slc38a6	T	A	12: 73,329,985	S138T	possibly damaging	Het
Spred1	T	C	2: 117,177,621	V336A	possibly damaging	Het
Syt11	T	C	3: 88,747,842	D78G	probably damaging	Het
Trim23	C	T	13: 104,181,174	T61I	probably damaging	Het
Tsg101	T	C	7: 46,892,426	T260A	probably damaging	Het
Tyw5	T	C	1: 57,401,459	Y48C	probably damaging	Het
Vmn1r17	A	G	6: 57,360,843	V130A	probably benign	Het
Vmn2r89	C	A	14: 51,456,163	H323Q	possibly damaging	Het
Vps18	A	G	2: 119,292,942	S117G	probably benign	Het
Zfp93	C	G	7: 24,276,332	Q581E	probably damaging	Het

Other mutations in Sptlc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01392:Sptlc3	APN	2	139546421	missense	possibly damaging	0.55
IGL01537:Sptlc3	APN	2	139589695	missense	possibly damaging	0.95
IGL01996:Sptlc3	APN	2	139581504	splice site	probably benign
IGL02512:Sptlc3	APN	2	139547203	missense	probably damaging	1.00
IGL03278:Sptlc3	APN	2	139589659	missense	probably damaging	1.00
IGL03286:Sptlc3	APN	2	139589659	missense	probably damaging	1.00
R0266:Sptlc3	UTSW	2	139596037	missense	possibly damaging	0.93
R0362:Sptlc3	UTSW	2	139546555	splice site	probably benign
R1464:Sptlc3	UTSW	2	139547234	missense	probably benign	0.00
R1464:Sptlc3	UTSW	2	139547234	missense	probably benign	0.00
R1494:Sptlc3	UTSW	2	139589560	missense	possibly damaging	0.58
R1847:Sptlc3	UTSW	2	139625923	missense	probably benign	0.08
R1919:Sptlc3	UTSW	2	139566675	missense	possibly damaging	0.66
R2093:Sptlc3	UTSW	2	139625874	missense	possibly damaging	0.89
R2396:Sptlc3	UTSW	2	139566586	missense	probably benign	0.44
R2972:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R2973:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R2974:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R4601:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4602:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4610:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4745:Sptlc3	UTSW	2	139547167	missense	probably damaging	1.00
R4779:Sptlc3	UTSW	2	139589589	missense	probably benign	0.04
R4992:Sptlc3	UTSW	2	139596003	missense	probably benign	0.04
R5401:Sptlc3	UTSW	2	139636723	missense	possibly damaging	0.75
R5406:Sptlc3	UTSW	2	139546478	missense	probably benign	0.26
R5642:Sptlc3	UTSW	2	139546408	missense	probably damaging	0.96
R5840:Sptlc3	UTSW	2	139547206	missense	probably damaging	1.00
R6057:Sptlc3	UTSW	2	139581613	missense	probably damaging	0.99
R6376:Sptlc3	UTSW	2	139636772	missense	probably benign	0.21
R6852:Sptlc3	UTSW	2	139566586	missense	probably benign	0.44
R7026:Sptlc3	UTSW	2	139537688	missense	probably benign
R7412:Sptlc3	UTSW	2	139589617	missense	possibly damaging	0.75
R7516:Sptlc3	UTSW	2	139589518	missense	probably benign	0.11
R7733:Sptlc3	UTSW	2	139631368	missense	possibly damaging	0.77
R7826:Sptlc3	UTSW	2	139547195	missense	probably benign	0.44
R7949:Sptlc3	UTSW	2	139625875	missense	possibly damaging	0.81
R9224:Sptlc3	UTSW	2	139494234	missense	probably benign	0.17
R9237:Sptlc3	UTSW	2	139566685	missense	probably benign	0.40
R9319:Sptlc3	UTSW	2	139636810	missense	possibly damaging	0.65
R9330:Sptlc3	UTSW	2	139546503	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCAAGCAATTGCCCTTTTCTTG -3'
(R):5'- GGATATTGCTGACATACCACAGTG -3'

Sequencing Primer
(F):5'- GTGTGGGAGAAAGATTAATCTTCC -3'
(R):5'- CACAGTGGTTTGTTGTTGTTTATTTG -3'

Posted On

2016-06-21