Incidental Mutation 'R5180:Gna11'
ID399740
Institutional Source Beutler Lab
Gene Symbol Gna11
Ensembl Gene ENSMUSG00000034781
Gene Nameguanine nucleotide binding protein, alpha 11
SynonymsDsk7
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5180 (G1)
Quality Score89
Status Validated
Chromosome10
Chromosomal Location81528724-81545190 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81544873 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 19 (K19E)
Ref Sequence ENSEMBL: ENSMUSP00000043190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043604]
Predicted Effect probably benign
Transcript: ENSMUST00000043604
AA Change: K19E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000043190
Gene: ENSMUSG00000034781
AA Change: K19E

DomainStartEndE-ValueType
G_alpha 19 358 3.09e-208 SMART
Meta Mutation Damage Score 0.0662 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of guanine nucleotide-binding proteins (G proteins), which function as modulators or transducers in various transmembrane signaling systems. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes one of the alpha subunits (subunit alpha-11). Mutations in this gene have been associated with hypocalciuric hypercalcemia type II (HHC2) and hypocalcemia dominant 2 (HYPOC2). Patients with HHC2 and HYPOC2 exhibit decreased or increased sensitivity, respectively, to changes in extracellular calcium concentrations. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice deficient for this gene do not exhibit any detectable abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Gna11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Gna11 APN 10 81530884 missense probably damaging 1.00
IGL02972:Gna11 APN 10 81533391 missense probably benign
IGL03290:Gna11 APN 10 81530937 missense probably damaging 1.00
R0057:Gna11 UTSW 10 81530940 missense probably benign 0.19
R0057:Gna11 UTSW 10 81530940 missense probably benign 0.19
R0417:Gna11 UTSW 10 81530904 missense probably damaging 1.00
R1542:Gna11 UTSW 10 81533328 missense probably benign
R1957:Gna11 UTSW 10 81530844 missense probably damaging 1.00
R5534:Gna11 UTSW 10 81531133 missense probably damaging 1.00
R5967:Gna11 UTSW 10 81530809 missense probably benign 0.11
R6445:Gna11 UTSW 10 81533333 missense probably damaging 1.00
R6523:Gna11 UTSW 10 81544854 missense probably damaging 1.00
R7450:Gna11 UTSW 10 81532522 missense
R7556:Gna11 UTSW 10 81531374 missense
Predicted Primers PCR Primer
(F):5'- CCCCGAATGAATCTAAGGCCTG -3'
(R):5'- CGATCCTAAAGTCCTGTCCC -3'

Sequencing Primer
(F):5'- ACTAGTTGCCCCGAGGACATC -3'
(R):5'- TAAAGTCCTGTCCCTGCGG -3'
Posted On2016-07-06