Incidental Mutation 'R5180:Gpr15'
ID399780
Institutional Source Beutler Lab
Gene Symbol Gpr15
Ensembl Gene ENSMUSG00000047293
Gene NameG protein-coupled receptor 15
Synonyms4933439K08Rik
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58717433-58719070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58717885 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 280 (L280F)
Ref Sequence ENSEMBL: ENSMUSP00000086731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089318]
Predicted Effect probably benign
Transcript: ENSMUST00000089318
AA Change: L280F

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000086731
Gene: ENSMUSG00000047293
AA Change: L280F

DomainStartEndE-ValueType
Pfam:7tm_1 50 302 1.3e-46 PFAM
Pfam:7TM_GPCR_Srv 66 317 7.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232532
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor that acts as a chemokine receptor for human immunodeficiency virus type 1 and 2. The encoded protein localizes to the cell membrane. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a a knock-out allele exhibit impaired regulatory T cell homing in the large intestine mucosa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Gpr15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Gpr15 APN 16 58718078 missense probably damaging 0.99
IGL02616:Gpr15 APN 16 58718204 missense probably damaging 1.00
IGL03381:Gpr15 APN 16 58717976 missense probably damaging 1.00
PIT4418001:Gpr15 UTSW 16 58717950 missense probably benign 0.13
R1484:Gpr15 UTSW 16 58718574 missense probably damaging 1.00
R1775:Gpr15 UTSW 16 58718558 missense probably benign 0.05
R1959:Gpr15 UTSW 16 58718007 missense probably benign 0.03
R1961:Gpr15 UTSW 16 58718007 missense probably benign 0.03
R2127:Gpr15 UTSW 16 58718255 missense possibly damaging 0.67
R3825:Gpr15 UTSW 16 58718360 missense probably damaging 1.00
R4957:Gpr15 UTSW 16 58718174 missense probably damaging 0.99
R5098:Gpr15 UTSW 16 58718527 missense probably damaging 1.00
R5668:Gpr15 UTSW 16 58717650 missense probably damaging 1.00
R6104:Gpr15 UTSW 16 58717976 missense probably damaging 1.00
R6281:Gpr15 UTSW 16 58718594 missense probably damaging 1.00
R6921:Gpr15 UTSW 16 58717781 missense probably benign 0.00
R6980:Gpr15 UTSW 16 58718742 start gained probably benign
R6981:Gpr15 UTSW 16 58718185 missense probably benign 0.44
R7252:Gpr15 UTSW 16 58718397 missense probably damaging 1.00
R7643:Gpr15 UTSW 16 58717816 nonsense probably null
R7680:Gpr15 UTSW 16 58717965 missense probably damaging 1.00
R7844:Gpr15 UTSW 16 58718510 missense probably damaging 1.00
R7954:Gpr15 UTSW 16 58718684 missense probably benign 0.00
R8100:Gpr15 UTSW 16 58717713 missense probably benign 0.00
R8372:Gpr15 UTSW 16 58718487 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTGACACAGATCTCTTCCTCCG -3'
(R):5'- CATTACCAGCAGTCGGGAAAG -3'

Sequencing Primer
(F):5'- ATCCTCTGCATGAATGAAGTTGG -3'
(R):5'- TACCAGCAGTCGGGAAAGCATAAC -3'
Posted On2016-07-06