Incidental Mutation 'R5277:Rslcan18'
ID404015
Institutional Source Beutler Lab
Gene Symbol Rslcan18
Ensembl Gene ENSMUSG00000074824
Gene Nameregulator of sex-limitation candidate 18
Synonyms
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67096613-67116263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 67098434 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 371 (E371D)
Ref Sequence ENSEMBL: ENSMUSP00000089111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091526] [ENSMUST00000109743] [ENSMUST00000186303]
Predicted Effect probably benign
Transcript: ENSMUST00000091526
AA Change: E371D

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000089111
Gene: ENSMUSG00000074824
AA Change: E371D

DomainStartEndE-ValueType
KRAB 96 156 5.31e-28 SMART
ZnF_C2H2 171 193 4.24e-4 SMART
ZnF_C2H2 199 221 1.56e-2 SMART
ZnF_C2H2 227 249 1.82e-3 SMART
ZnF_C2H2 255 277 1.82e-3 SMART
ZnF_C2H2 283 305 3.26e-5 SMART
ZnF_C2H2 311 333 1.82e-3 SMART
ZnF_C2H2 339 361 1.26e-2 SMART
ZnF_C2H2 367 389 2.12e-4 SMART
ZnF_C2H2 395 417 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109743
SMART Domains Protein: ENSMUSP00000105365
Gene: ENSMUSG00000058883

DomainStartEndE-ValueType
KRAB 17 77 3.75e-28 SMART
ZnF_C2H2 93 115 1.12e-3 SMART
ZnF_C2H2 121 143 5.14e-3 SMART
ZnF_C2H2 149 171 1.1e-2 SMART
ZnF_C2H2 177 199 6.78e-3 SMART
ZnF_C2H2 205 227 1.47e-3 SMART
ZnF_C2H2 233 255 7.78e-3 SMART
ZnF_C2H2 261 283 1.95e-3 SMART
ZnF_C2H2 289 311 5.21e-4 SMART
ZnF_C2H2 317 339 7.9e-4 SMART
ZnF_C2H2 345 367 8.34e-3 SMART
ZnF_C2H2 373 395 1.3e-4 SMART
ZnF_C2H2 401 423 4.87e-4 SMART
ZnF_C2H2 429 451 5.14e-3 SMART
ZnF_C2H2 457 479 1.2e-3 SMART
ZnF_C2H2 485 507 1.72e-4 SMART
ZnF_C2H2 513 535 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185954
Predicted Effect probably benign
Transcript: ENSMUST00000186303
AA Change: E247D

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140296
Gene: ENSMUSG00000100235
AA Change: E247D

DomainStartEndE-ValueType
KRAB 1 32 9.7e-3 SMART
ZnF_C2H2 47 69 1.8e-6 SMART
ZnF_C2H2 75 97 6.7e-5 SMART
ZnF_C2H2 103 125 7.6e-6 SMART
ZnF_C2H2 131 153 7.6e-6 SMART
ZnF_C2H2 159 181 1.4e-7 SMART
ZnF_C2H2 187 209 7.6e-6 SMART
ZnF_C2H2 215 237 5.5e-5 SMART
ZnF_C2H2 243 265 8.9e-7 SMART
ZnF_C2H2 271 293 2e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225558
Meta Mutation Damage Score 0.1021 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Rslcan18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Rslcan18 APN 13 67102108 missense probably benign 0.01
IGL01760:Rslcan18 APN 13 67113951 missense probably benign 0.04
R0003:Rslcan18 UTSW 13 67098469 missense probably benign 0.01
R0333:Rslcan18 UTSW 13 67098622 missense probably damaging 0.99
R0505:Rslcan18 UTSW 13 67102119 missense probably benign 0.31
R0525:Rslcan18 UTSW 13 67112258 missense probably benign 0.03
R0898:Rslcan18 UTSW 13 67098816 missense probably benign 0.02
R1449:Rslcan18 UTSW 13 67102100 missense possibly damaging 0.65
R1511:Rslcan18 UTSW 13 67098952 missense possibly damaging 0.94
R1575:Rslcan18 UTSW 13 67108057 intron probably benign
R1973:Rslcan18 UTSW 13 67108023 intron probably benign
R3109:Rslcan18 UTSW 13 67098607 missense possibly damaging 0.53
R4707:Rslcan18 UTSW 13 67098526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGTCTGAATAGTAAAGCACTCTC -3'
(R):5'- GACAAATGTCCCTAAGCTTTTCTTCTT -3'

Sequencing Primer
(F):5'- TCTCCACACTCATCACAGGTG -3'
(R):5'- GGCAAAAAGTTTTCCAGTCCTGC -3'
Posted On2016-07-22