Incidental Mutation 'R0468:Hibadh'
ID41746
Institutional Source Beutler Lab
Gene Symbol Hibadh
Ensembl Gene ENSMUSG00000029776
Gene Name3-hydroxyisobutyrate dehydrogenase
Synonyms
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0468 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location52546228-52640389 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 52557770 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031788]
Predicted Effect probably benign
Transcript: ENSMUST00000031788
SMART Domains Protein: ENSMUSP00000031788
Gene: ENSMUSG00000029776

DomainStartEndE-ValueType
Pfam:2-Hacid_dh_C 19 154 4.6e-10 PFAM
Pfam:NAD_binding_2 38 200 1.3e-51 PFAM
Pfam:F420_oxidored 40 133 3.4e-7 PFAM
Pfam:NAD_binding_11 202 329 6.1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204075
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial 3-hydroxyisobutyrate dehydrogenase enzyme. The encoded protein plays a critical role in the catabolism of L-valine by catalyzing the oxidation of 3-hydroxyisobutyrate to methylmalonate semialdehyde. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Hibadh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02407:Hibadh APN 6 52548889 missense possibly damaging 0.93
IGL03116:Hibadh APN 6 52548932 missense probably damaging 1.00
R0103:Hibadh UTSW 6 52557877 missense probably benign 0.25
R0103:Hibadh UTSW 6 52557877 missense probably benign 0.25
R0800:Hibadh UTSW 6 52556505 missense probably damaging 1.00
R1950:Hibadh UTSW 6 52556463 missense probably benign 0.10
R4379:Hibadh UTSW 6 52620042 missense probably damaging 0.98
R4614:Hibadh UTSW 6 52546930 missense possibly damaging 0.85
R4987:Hibadh UTSW 6 52622895 missense probably damaging 1.00
R5073:Hibadh UTSW 6 52620094 missense possibly damaging 0.90
R5074:Hibadh UTSW 6 52620094 missense possibly damaging 0.90
R5402:Hibadh UTSW 6 52546980 missense probably benign 0.32
R6390:Hibadh UTSW 6 52556489 missense probably damaging 1.00
R6575:Hibadh UTSW 6 52547028 missense probably damaging 1.00
R7360:Hibadh UTSW 6 52640212 missense probably benign
R7974:Hibadh UTSW 6 52557895 missense probably benign 0.44
Z1177:Hibadh UTSW 6 52619995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTGGGCAAATGGGATATGTGC -3'
(R):5'- TCCCAAATGACTCAGGTGTAGGAGC -3'

Sequencing Primer
(F):5'- AGGGGCACTTAGTTCTATTAAGAG -3'
(R):5'- AGCTGCTCGGTCTGGAAAC -3'
Posted On2013-05-23