Incidental Mutation 'R5362:Kif9'
ID422881
Institutional Source Beutler Lab
Gene Symbol Kif9
Ensembl Gene ENSMUSG00000032489
Gene Namekinesin family member 9
Synonyms
MMRRC Submission 043264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5362 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110476958-110525179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 110489944 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 159 (V159M)
Ref Sequence ENSEMBL: ENSMUSP00000057896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043] [ENSMUST00000198858]
Predicted Effect probably damaging
Transcript: ENSMUST00000061155
AA Change: V159M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489
AA Change: V159M

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084952
AA Change: V159M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489
AA Change: V159M

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197248
AA Change: V159M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489
AA Change: V159M

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 6e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198043
AA Change: V159M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489
AA Change: V159M

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 476 5e-14 BLAST
low complexity region 489 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198858
SMART Domains Protein: ENSMUSP00000142888
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 9 144 6.7e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Kif9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Kif9 APN 9 110485070 missense probably benign 0.03
IGL02273:Kif9 APN 9 110510470 missense probably damaging 0.99
IGL02818:Kif9 APN 9 110485149 missense probably damaging 1.00
R0034:Kif9 UTSW 9 110519611 missense probably benign 0.23
R0034:Kif9 UTSW 9 110519611 missense probably benign 0.23
R0047:Kif9 UTSW 9 110485038 missense probably benign 0.05
R0047:Kif9 UTSW 9 110485038 missense probably benign 0.05
R0137:Kif9 UTSW 9 110485038 missense probably damaging 1.00
R0594:Kif9 UTSW 9 110511340 missense probably benign 0.22
R1503:Kif9 UTSW 9 110510438 missense possibly damaging 0.89
R1657:Kif9 UTSW 9 110489966 missense possibly damaging 0.82
R1826:Kif9 UTSW 9 110517633 missense probably benign 0.34
R1856:Kif9 UTSW 9 110517719 missense probably null 1.00
R2076:Kif9 UTSW 9 110485032 splice site probably null
R3407:Kif9 UTSW 9 110519140 missense probably damaging 1.00
R4247:Kif9 UTSW 9 110495959 critical splice donor site probably null
R4487:Kif9 UTSW 9 110494484 missense probably null 1.00
R4515:Kif9 UTSW 9 110489867 missense probably benign 0.38
R4880:Kif9 UTSW 9 110501635 missense probably damaging 0.98
R5024:Kif9 UTSW 9 110483093 missense possibly damaging 0.81
R5093:Kif9 UTSW 9 110489897 missense probably damaging 1.00
R5181:Kif9 UTSW 9 110521268 missense probably damaging 1.00
R5379:Kif9 UTSW 9 110521303 missense probably benign 0.00
R5628:Kif9 UTSW 9 110514553 nonsense probably null
R5653:Kif9 UTSW 9 110524931 missense probably damaging 1.00
R5698:Kif9 UTSW 9 110510464 missense probably benign
R5758:Kif9 UTSW 9 110489879 missense probably damaging 1.00
R5986:Kif9 UTSW 9 110490026 missense probably benign 0.05
R6103:Kif9 UTSW 9 110489849 missense possibly damaging 0.82
R6247:Kif9 UTSW 9 110488544 missense possibly damaging 0.78
R6255:Kif9 UTSW 9 110517834 splice site probably null
R6991:Kif9 UTSW 9 110494622 missense probably damaging 1.00
R7113:Kif9 UTSW 9 110506664 missense probably damaging 1.00
R7459:Kif9 UTSW 9 110519041 missense probably damaging 1.00
R7593:Kif9 UTSW 9 110521353 missense possibly damaging 0.54
R7892:Kif9 UTSW 9 110514614 missense not run
R8050:Kif9 UTSW 9 110519140 missense probably damaging 1.00
R8370:Kif9 UTSW 9 110488613 missense probably damaging 1.00
R8549:Kif9 UTSW 9 110514419 splice site probably null
R8751:Kif9 UTSW 9 110501656 missense probably benign 0.03
R8830:Kif9 UTSW 9 110524930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGACAGGAATTGCCCCG -3'
(R):5'- TCTTACAGAACACAGGGTTTGC -3'

Sequencing Primer
(F):5'- CCTCCTGAGGGAAGATGTGG -3'
(R):5'- CAGAACACAGGGTTTGCTATATAAGC -3'
Posted On2016-08-04