Incidental Mutation 'R5382:Cga'
ID424776
Institutional Source Beutler Lab
Gene Symbol Cga
Ensembl Gene ENSMUSG00000028298
Gene Nameglycoprotein hormones, alpha subunit
SynonymsGPHalpha, alphaSU, aGSU, alphaGSU, alpha-GSU, Tsha
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R5382 (G1)
Quality Score211
Status Validated
Chromosome4
Chromosomal Location34893779-34907370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34904048 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 14 (M14I)
Ref Sequence ENSEMBL: ENSMUSP00000119152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029975] [ENSMUST00000108130] [ENSMUST00000135871]
Predicted Effect probably benign
Transcript: ENSMUST00000029975
AA Change: M14I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029975
Gene: ENSMUSG00000028298
AA Change: M14I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GHA 34 120 3.31e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108130
AA Change: M14I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103765
Gene: ENSMUSG00000028298
AA Change: M14I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GHA 34 120 3.31e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135871
AA Change: M14I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119152
Gene: ENSMUSG00000028298
AA Change: M14I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GHA 34 117 7.56e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149572
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mutants exhibit male and female sterility with hypogonadism, dwarfism, hypothyroidism, and both hypertrophy and hyperplasia of pituitary thyrotropes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Cga
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4283:Cga UTSW 4 34905264 critical splice donor site probably null
R5743:Cga UTSW 4 34904108 critical splice donor site probably null
R6952:Cga UTSW 4 34905171 missense possibly damaging 0.80
R7388:Cga UTSW 4 34907076 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGCAATAATGTTAAACTTACTGGTTG -3'
(R):5'- AAGATGTGTATCCAGAAGTGACTATT -3'

Sequencing Primer
(F):5'- ATACAGCTCAGTCGTAGAGCAGTAC -3'
(R):5'- GACTATTTATCACATGTGAAAGACGG -3'
Posted On2016-08-04