Incidental Mutation 'R5382:Trpm3'
ID424820
Institutional Source Beutler Lab
Gene Symbol Trpm3
Ensembl Gene ENSMUSG00000052387
Gene Nametransient receptor potential cation channel, subfamily M, member 3
SynonymsB930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5382 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location22139119-22989884 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 22885341 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000087576] [ENSMUST00000099564] [ENSMUST00000099564] [ENSMUST00000099569] [ENSMUST00000099569]
Predicted Effect probably null
Transcript: ENSMUST00000037901
SMART Domains Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387

DomainStartEndE-ValueType
Blast:ANK 485 514 1e-6 BLAST
low complexity region 619 631 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 788 800 N/A INTRINSIC
low complexity region 821 840 N/A INTRINSIC
Pfam:Ion_trans 883 1136 1.7e-19 PFAM
Pfam:TRPM_tetra 1227 1282 1.5e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000037901
SMART Domains Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387

DomainStartEndE-ValueType
Blast:ANK 485 514 1e-6 BLAST
low complexity region 619 631 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 788 800 N/A INTRINSIC
low complexity region 821 840 N/A INTRINSIC
Pfam:Ion_trans 883 1136 1.7e-19 PFAM
Pfam:TRPM_tetra 1227 1282 1.5e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000074770
SMART Domains Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 611 623 N/A INTRINSIC
low complexity region 666 681 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 813 832 N/A INTRINSIC
transmembrane domain 874 896 N/A INTRINSIC
Pfam:Ion_trans 908 1116 5.1e-14 PFAM
low complexity region 1378 1388 N/A INTRINSIC
low complexity region 1433 1455 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000074770
SMART Domains Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 611 623 N/A INTRINSIC
low complexity region 666 681 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 813 832 N/A INTRINSIC
transmembrane domain 874 896 N/A INTRINSIC
Pfam:Ion_trans 908 1116 5.1e-14 PFAM
low complexity region 1378 1388 N/A INTRINSIC
low complexity region 1433 1455 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000087576
SMART Domains Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 621 633 N/A INTRINSIC
low complexity region 676 691 N/A INTRINSIC
low complexity region 790 802 N/A INTRINSIC
low complexity region 823 842 N/A INTRINSIC
transmembrane domain 884 906 N/A INTRINSIC
Pfam:Ion_trans 918 1126 5.1e-14 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000087576
SMART Domains Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 621 633 N/A INTRINSIC
low complexity region 676 691 N/A INTRINSIC
low complexity region 790 802 N/A INTRINSIC
low complexity region 823 842 N/A INTRINSIC
transmembrane domain 884 906 N/A INTRINSIC
Pfam:Ion_trans 918 1126 5.1e-14 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099564
SMART Domains Protein: ENSMUSP00000097160
Gene: ENSMUSG00000052387

DomainStartEndE-ValueType
low complexity region 451 463 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 653 672 N/A INTRINSIC
transmembrane domain 714 736 N/A INTRINSIC
Pfam:Ion_trans 748 919 1.5e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099564
SMART Domains Protein: ENSMUSP00000097160
Gene: ENSMUSG00000052387

DomainStartEndE-ValueType
low complexity region 451 463 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 653 672 N/A INTRINSIC
transmembrane domain 714 736 N/A INTRINSIC
Pfam:Ion_trans 748 919 1.5e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099569
SMART Domains Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 6e-7 BLAST
low complexity region 609 621 N/A INTRINSIC
low complexity region 664 679 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
Pfam:Ion_trans 873 1138 3.2e-19 PFAM
Pfam:TRPM_tetra 1229 1284 4.4e-26 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099569
SMART Domains Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 6e-7 BLAST
low complexity region 609 621 N/A INTRINSIC
low complexity region 664 679 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
Pfam:Ion_trans 873 1138 3.2e-19 PFAM
Pfam:TRPM_tetra 1229 1284 4.4e-26 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Trpm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Trpm3 APN 19 22987659 missense probably benign 0.00
IGL00773:Trpm3 APN 19 22900159 missense possibly damaging 0.92
IGL00852:Trpm3 APN 19 22987071 missense possibly damaging 0.93
IGL01597:Trpm3 APN 19 22715246 missense probably damaging 1.00
IGL01607:Trpm3 APN 19 22987127 missense probably benign 0.01
IGL01818:Trpm3 APN 19 22914474 missense probably damaging 1.00
IGL01890:Trpm3 APN 19 22711719 missense probably damaging 0.98
IGL02016:Trpm3 APN 19 22902069 nonsense probably null
IGL02324:Trpm3 APN 19 22698779 missense probably benign 0.25
IGL02947:Trpm3 APN 19 22901119 missense probably damaging 0.99
IGL03037:Trpm3 APN 19 22889412 missense possibly damaging 0.85
IGL03128:Trpm3 APN 19 22914465 missense probably damaging 1.00
IGL03335:Trpm3 APN 19 22926071 critical splice donor site probably null
IGL03354:Trpm3 APN 19 22856718 missense probably damaging 1.00
bit UTSW 19 22987869 missense probably benign 0.00
P0041:Trpm3 UTSW 19 22897686 missense probably benign 0.01
R0001:Trpm3 UTSW 19 22715331 missense possibly damaging 0.70
R0007:Trpm3 UTSW 19 22987529 missense probably benign 0.00
R0007:Trpm3 UTSW 19 22987529 missense probably benign 0.00
R0009:Trpm3 UTSW 19 22914446 missense probably damaging 1.00
R0009:Trpm3 UTSW 19 22914446 missense probably damaging 1.00
R0142:Trpm3 UTSW 19 22987916 missense probably damaging 0.98
R0194:Trpm3 UTSW 19 22715356 splice site probably null
R0268:Trpm3 UTSW 19 22897521 critical splice donor site probably null
R0299:Trpm3 UTSW 19 22986873 missense possibly damaging 0.62
R0449:Trpm3 UTSW 19 22988054 missense probably benign
R0481:Trpm3 UTSW 19 22901071 missense possibly damaging 0.51
R0496:Trpm3 UTSW 19 22698778 missense probably benign 0.00
R0499:Trpm3 UTSW 19 22986873 missense possibly damaging 0.62
R0550:Trpm3 UTSW 19 22987812 missense probably damaging 0.97
R0729:Trpm3 UTSW 19 22987789 missense probably benign
R0883:Trpm3 UTSW 19 22978654 missense probably damaging 1.00
R0926:Trpm3 UTSW 19 22988043 missense probably benign 0.02
R1185:Trpm3 UTSW 19 22914417 splice site probably benign
R1185:Trpm3 UTSW 19 22914417 splice site probably benign
R1513:Trpm3 UTSW 19 22986872 missense possibly damaging 0.96
R1521:Trpm3 UTSW 19 22901221 missense probably damaging 1.00
R1522:Trpm3 UTSW 19 22978334 missense probably benign 0.39
R1569:Trpm3 UTSW 19 22889445 critical splice donor site probably null
R1598:Trpm3 UTSW 19 22733024 missense possibly damaging 0.47
R1600:Trpm3 UTSW 19 22139155 missense probably benign 0.00
R1616:Trpm3 UTSW 19 22982712 missense probably damaging 1.00
R1619:Trpm3 UTSW 19 22711907 missense probably damaging 0.99
R1923:Trpm3 UTSW 19 22885412 missense probably damaging 1.00
R1985:Trpm3 UTSW 19 22926082 missense possibly damaging 0.56
R2002:Trpm3 UTSW 19 22982583 missense probably damaging 1.00
R2249:Trpm3 UTSW 19 22733034 missense probably benign 0.15
R3719:Trpm3 UTSW 19 22986990 missense possibly damaging 0.95
R3766:Trpm3 UTSW 19 22448377 missense probably benign
R3774:Trpm3 UTSW 19 22978602 missense possibly damaging 0.66
R3774:Trpm3 UTSW 19 22987975 missense probably benign 0.03
R3776:Trpm3 UTSW 19 22978602 missense possibly damaging 0.66
R3820:Trpm3 UTSW 19 22987449 missense probably benign 0.00
R3899:Trpm3 UTSW 19 22901160 missense possibly damaging 0.90
R4204:Trpm3 UTSW 19 22987564 missense probably benign 0.00
R4238:Trpm3 UTSW 19 22978638 missense probably damaging 1.00
R4301:Trpm3 UTSW 19 22987292 missense probably benign 0.23
R4344:Trpm3 UTSW 19 22897697 missense probably damaging 0.99
R4345:Trpm3 UTSW 19 22897697 missense probably damaging 0.99
R4365:Trpm3 UTSW 19 22978330 missense probably benign 0.00
R4510:Trpm3 UTSW 19 22988017 missense probably benign 0.00
R4511:Trpm3 UTSW 19 22988017 missense probably benign 0.00
R4565:Trpm3 UTSW 19 22987869 missense probably benign 0.00
R4573:Trpm3 UTSW 19 22902142 missense probably damaging 1.00
R4606:Trpm3 UTSW 19 22978624 missense probably benign 0.26
R4677:Trpm3 UTSW 19 22987388 missense possibly damaging 0.95
R4684:Trpm3 UTSW 19 22987781 missense probably benign
R4713:Trpm3 UTSW 19 22889435 missense possibly damaging 0.83
R4745:Trpm3 UTSW 19 22715295 missense possibly damaging 0.67
R5015:Trpm3 UTSW 19 22711712 missense probably damaging 1.00
R5030:Trpm3 UTSW 19 22698766 missense probably benign 0.01
R5074:Trpm3 UTSW 19 22885349 missense possibly damaging 0.65
R5089:Trpm3 UTSW 19 22766756 missense probably damaging 0.97
R5100:Trpm3 UTSW 19 22918766 missense probably damaging 0.99
R5108:Trpm3 UTSW 19 22904714 missense probably benign 0.06
R5204:Trpm3 UTSW 19 22448341 nonsense probably null
R5213:Trpm3 UTSW 19 22697454 nonsense probably null
R5358:Trpm3 UTSW 19 22925968 missense probably damaging 1.00
R5374:Trpm3 UTSW 19 22926184 nonsense probably null
R5509:Trpm3 UTSW 19 22987258 missense probably damaging 0.99
R5558:Trpm3 UTSW 19 22978573 missense probably damaging 1.00
R6154:Trpm3 UTSW 19 22987814 missense probably damaging 1.00
R6250:Trpm3 UTSW 19 22910054 missense probably benign 0.01
R6433:Trpm3 UTSW 19 22901305 missense probably damaging 1.00
R6542:Trpm3 UTSW 19 22926113 missense probably benign 0.04
R6630:Trpm3 UTSW 19 22987983 missense probably benign 0.00
R6640:Trpm3 UTSW 19 22978582 missense probably damaging 1.00
R6725:Trpm3 UTSW 19 22926028 missense probably damaging 1.00
R7275:Trpm3 UTSW 19 22978684 missense possibly damaging 0.71
R7371:Trpm3 UTSW 19 22902193 missense probably benign 0.27
R7467:Trpm3 UTSW 19 22978334 missense possibly damaging 0.82
R7488:Trpm3 UTSW 19 22978573 missense probably damaging 1.00
R7495:Trpm3 UTSW 19 22897796 missense probably benign 0.28
R7600:Trpm3 UTSW 19 22926094 missense possibly damaging 0.68
R7710:Trpm3 UTSW 19 22918790 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGGATCCTGAGGCTCCAGAAC -3'
(R):5'- TGAAAAGGCATCTTAGCTTGGC -3'

Sequencing Primer
(F):5'- AAGTAGCTTCTAGACCTGGAGTC -3'
(R):5'- AAAGGCATCTTAGCTTGGCCCTAC -3'
Posted On2016-08-04