Incidental Mutation 'R5382:Olfr798'
ID424796
Institutional Source Beutler Lab
Gene Symbol Olfr798
Ensembl Gene ENSMUSG00000095002
Gene Nameolfactory receptor 798
SynonymsGA_x6K02T2PULF-11304679-11303744, MOR108-1
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R5382 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129622615-129627934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129626007 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 18 (D18V)
Ref Sequence ENSEMBL: ENSMUSP00000144716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079810] [ENSMUST00000204979]
Predicted Effect probably damaging
Transcript: ENSMUST00000079810
AA Change: D18V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078739
Gene: ENSMUSG00000095002
AA Change: D18V

DomainStartEndE-ValueType
Pfam:7tm_4 28 309 5e-52 PFAM
Pfam:7tm_1 39 288 2.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203614
Predicted Effect probably damaging
Transcript: ENSMUST00000204979
AA Change: D18V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144716
Gene: ENSMUSG00000095002
AA Change: D18V

DomainStartEndE-ValueType
Pfam:7tm_4 28 309 5e-52 PFAM
Pfam:7tm_1 39 288 2.1e-25 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Olfr798
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Olfr798 APN 10 129625563 missense probably damaging 1.00
IGL02866:Olfr798 APN 10 129625706 nonsense probably null
BB009:Olfr798 UTSW 10 129625225 missense probably damaging 0.97
BB019:Olfr798 UTSW 10 129625225 missense probably damaging 0.97
R0743:Olfr798 UTSW 10 129625843 missense probably benign 0.03
R1163:Olfr798 UTSW 10 129625647 missense possibly damaging 0.79
R1192:Olfr798 UTSW 10 129626037 missense probably benign
R1863:Olfr798 UTSW 10 129625348 missense probably damaging 0.96
R1867:Olfr798 UTSW 10 129625752 missense probably damaging 0.99
R2508:Olfr798 UTSW 10 129625915 missense probably benign
R4898:Olfr798 UTSW 10 129625599 missense probably benign 0.12
R4910:Olfr798 UTSW 10 129625807 missense probably damaging 0.98
R4988:Olfr798 UTSW 10 129626061 splice site probably null
R5361:Olfr798 UTSW 10 129625732 missense probably damaging 1.00
R5589:Olfr798 UTSW 10 129625450 missense probably damaging 1.00
R5693:Olfr798 UTSW 10 129625527 missense probably damaging 0.99
R5790:Olfr798 UTSW 10 129625888 missense probably damaging 1.00
R6966:Olfr798 UTSW 10 129625764 missense probably benign 0.17
R7041:Olfr798 UTSW 10 129625734 missense probably damaging 1.00
R7082:Olfr798 UTSW 10 129625765 missense probably benign 0.07
R7932:Olfr798 UTSW 10 129625225 missense probably damaging 0.97
R7977:Olfr798 UTSW 10 129625969 missense probably benign
R7987:Olfr798 UTSW 10 129625969 missense probably benign
R8299:Olfr798 UTSW 10 129625960 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAATGCTCACAAGGAAGCG -3'
(R):5'- CACCAGATGCATAGGTGTTTTG -3'

Sequencing Primer
(F):5'- CTCACAAGGAAGCGAGGAATG -3'
(R):5'- TGAAAGACTTAATGTTTCAGCTCG -3'
Posted On2016-08-04