Incidental Mutation 'R5368:Gtpbp2'
ID429504
Institutional Source Beutler Lab
Gene Symbol Gtpbp2
Ensembl Gene ENSMUSG00000023952
Gene NameGTP binding protein 2
Synonyms
MMRRC Submission 043204-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R5368 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46161032-46169370 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 46166304 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024748] [ENSMUST00000166563] [ENSMUST00000169383] [ENSMUST00000172170]
Predicted Effect probably benign
Transcript: ENSMUST00000024748
SMART Domains Protein: ENSMUSP00000024748
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Pfam:GTP_EFTU 172 412 4.2e-27 PFAM
low complexity region 418 429 N/A INTRINSIC
Pfam:GTP_EFTU_D3 499 589 8.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165686
Predicted Effect probably benign
Transcript: ENSMUST00000166252
Predicted Effect probably benign
Transcript: ENSMUST00000166563
SMART Domains Protein: ENSMUSP00000127896
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166663
Predicted Effect probably benign
Transcript: ENSMUST00000166701
SMART Domains Protein: ENSMUSP00000131772
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
SCOP:d1f60a2 69 111 1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167681
Predicted Effect probably benign
Transcript: ENSMUST00000169383
SMART Domains Protein: ENSMUSP00000133050
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171901
Predicted Effect probably benign
Transcript: ENSMUST00000172170
SMART Domains Protein: ENSMUSP00000128517
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Pfam:GTP_EFTU 172 411 9.4e-27 PFAM
low complexity region 418 429 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GTP-binding proteins, or G proteins, constitute a superfamily capable of binding GTP or GDP. G proteins are activated by binding GTP and are inactivated by hydrolyzing GTP to GDP. This general mechanism enables G proteins to perform a wide range of biologic activities.[supplied by OMIM, Jan 2003]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 131,139,196 H97L possibly damaging Het
Abca9 T A 11: 110,145,546 N579I probably damaging Het
Acbd3 A T 1: 180,722,095 probably benign Het
Ankrd50 A T 3: 38,455,050 I1056N probably damaging Het
Ceacam18 T C 7: 43,642,034 V300A probably benign Het
Cfap46 C A 7: 139,627,473 R1843S possibly damaging Het
D430041D05Rik A G 2: 104,248,284 V1229A probably damaging Het
Dbx2 G A 15: 95,640,641 S206L probably benign Het
Dnah11 A T 12: 117,954,893 D1530E probably damaging Het
Ecm2 A C 13: 49,520,943 T280P probably benign Het
Emc2 G A 15: 43,511,811 probably null Het
Epb42 C T 2: 121,019,462 V689I probably benign Het
Fam114a1 T A 5: 65,006,109 M209K possibly damaging Het
Fam117a C T 11: 95,375,633 S193F probably damaging Het
Foxp2 A T 6: 15,377,914 probably benign Het
Frmd6 T A 12: 70,864,100 C19* probably null Het
Fyb A G 15: 6,580,678 probably null Het
Gata6 C A 18: 11,063,059 H442Q possibly damaging Het
Gldc A G 19: 30,158,521 S160P probably benign Het
Gm3952 A G 8: 128,745,974 S1626P possibly damaging Het
Gm9762 T A 3: 78,966,435 noncoding transcript Het
Hgd A T 16: 37,589,751 T50S probably benign Het
Itpr1 C T 6: 108,387,498 T22M probably damaging Het
Kif26b G A 1: 178,915,884 E1182K probably damaging Het
Kirrel3 A G 9: 35,007,738 E230G probably damaging Het
Leng8 A G 7: 4,139,988 Y88C probably damaging Het
Lpo T C 11: 87,821,069 D54G possibly damaging Het
Lypd2 G T 15: 74,733,059 A29E probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mical3 T C 6: 120,959,473 Y1364C probably damaging Het
Mroh2b A G 15: 4,905,572 N163S probably damaging Het
Mtf1 G A 4: 124,825,079 C295Y probably damaging Het
Nbn T A 4: 15,969,391 L212Q probably damaging Het
Obscn A T 11: 59,069,026 probably null Het
Olfr1118 T A 2: 87,308,782 probably null Het
Olfr1215 A G 2: 89,002,091 S66P probably damaging Het
Peli1 A G 11: 21,148,389 T375A probably damaging Het
Picalm T C 7: 90,207,595 *611Q probably null Het
Plch1 G T 3: 63,701,973 Q938K possibly damaging Het
Plxnb2 A G 15: 89,159,593 V1352A possibly damaging Het
Pmepa1 G A 2: 173,228,322 R147W probably damaging Het
Prdm16 T G 4: 154,345,391 K373Q probably damaging Het
Qk T G 17: 10,239,035 E135A probably damaging Het
Rad50 T C 11: 53,684,246 K556E probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Smg8 G A 11: 87,080,260 S895L probably benign Het
Sorl1 T C 9: 41,979,390 I1944M probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tmprss7 A T 16: 45,660,889 W645R probably damaging Het
Tns1 T C 1: 73,941,017 M1111V probably benign Het
Ttn A C 2: 76,778,382 D17763E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 G A 4: 139,397,528 probably benign Het
Usp31 T C 7: 121,661,365 H637R probably damaging Het
Vps50 A C 6: 3,567,739 E545A possibly damaging Het
Wdfy3 G T 5: 101,872,858 L2527M probably damaging Het
Wfdc2 T C 2: 164,563,434 V85A possibly damaging Het
Other mutations in Gtpbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Gtpbp2 APN 17 46168254 missense probably damaging 1.00
IGL01534:Gtpbp2 APN 17 46163504 missense probably damaging 1.00
IGL02272:Gtpbp2 APN 17 46164781 missense probably benign 0.00
IGL02864:Gtpbp2 APN 17 46165594 missense probably benign 0.00
R0894:Gtpbp2 UTSW 17 46165969 missense possibly damaging 0.85
R1575:Gtpbp2 UTSW 17 46165943 missense probably damaging 1.00
R1632:Gtpbp2 UTSW 17 46168592 missense probably benign
R1639:Gtpbp2 UTSW 17 46165771 splice site probably null
R1786:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2132:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2133:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2223:Gtpbp2 UTSW 17 46167227 missense probably benign
R3742:Gtpbp2 UTSW 17 46165882 missense probably benign 0.03
R4060:Gtpbp2 UTSW 17 46167327 missense probably damaging 1.00
R4061:Gtpbp2 UTSW 17 46167327 missense probably damaging 1.00
R4064:Gtpbp2 UTSW 17 46167327 missense probably damaging 1.00
R4387:Gtpbp2 UTSW 17 46166358 missense probably benign 0.03
R4469:Gtpbp2 UTSW 17 46161313 missense probably damaging 0.99
R4583:Gtpbp2 UTSW 17 46161145 missense probably damaging 0.99
R4664:Gtpbp2 UTSW 17 46161154 missense probably benign 0.33
R4724:Gtpbp2 UTSW 17 46167221 critical splice acceptor site probably null
R5338:Gtpbp2 UTSW 17 46167834 missense probably damaging 1.00
R5832:Gtpbp2 UTSW 17 46167862 missense probably damaging 0.98
R6490:Gtpbp2 UTSW 17 46168221 missense probably benign 0.01
R6526:Gtpbp2 UTSW 17 46164111 intron probably null
R6723:Gtpbp2 UTSW 17 46168276 missense probably benign 0.05
R6860:Gtpbp2 UTSW 17 46167988 intron probably benign
R7336:Gtpbp2 UTSW 17 46161313 missense probably damaging 0.99
R7662:Gtpbp2 UTSW 17 46166435 missense probably benign 0.00
R7710:Gtpbp2 UTSW 17 46167787 missense possibly damaging 0.92
R8021:Gtpbp2 UTSW 17 46164269 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATTGTGGGAGGGAGCTAACC -3'
(R):5'- ATGCTCAGGCTTTGTCAGAACTG -3'

Sequencing Primer
(F):5'- CTAACCTGGAGCTTTGTTGATGTC -3'
(R):5'- TTTGTCAGAACTGGGCCAGC -3'
Posted On2016-09-06