Incidental Mutation 'R5810:Actr3'
ID501530
Institutional Source Beutler Lab
Gene Symbol Actr3
Ensembl Gene ENSMUSG00000026341
Gene NameARP3 actin-related protein 3
Synonyms1200003A09Rik, Arp3
MMRRC Submission 043395-MU
Accession Numbers

Ncbi RefSeq: NM_023735.2, NM_001205385.1, NM_001205386.1; MGI: 1921367

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location125392905-125435727 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 125416379 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027579] [ENSMUST00000178474] [ENSMUST00000185280] [ENSMUST00000187460] [ENSMUST00000188497] [ENSMUST00000191004] [ENSMUST00000191544] [ENSMUST00000191578]
Predicted Effect silent
Transcript: ENSMUST00000027579
SMART Domains Protein: ENSMUSP00000027579
Gene: ENSMUSG00000026341

DomainStartEndE-ValueType
ACTIN 5 413 1.62e-186 SMART
Predicted Effect silent
Transcript: ENSMUST00000178474
SMART Domains Protein: ENSMUSP00000137503
Gene: ENSMUSG00000026341

DomainStartEndE-ValueType
ACTIN 5 413 1.62e-186 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185280
SMART Domains Protein: ENSMUSP00000140082
Gene: ENSMUSG00000026341

DomainStartEndE-ValueType
Pfam:Actin 1 70 2.7e-17 PFAM
Predicted Effect silent
Transcript: ENSMUST00000187460
SMART Domains Protein: ENSMUSP00000140000
Gene: ENSMUSG00000026341

DomainStartEndE-ValueType
ACTIN 5 161 3.4e-7 SMART
Predicted Effect silent
Transcript: ENSMUST00000188497
SMART Domains Protein: ENSMUSP00000140535
Gene: ENSMUSG00000026341

DomainStartEndE-ValueType
ACTIN 5 216 7.6e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188827
Predicted Effect probably benign
Transcript: ENSMUST00000191004
SMART Domains Protein: ENSMUSP00000140953
Gene: ENSMUSG00000026341

DomainStartEndE-ValueType
Pfam:Actin 2 129 2.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191544
SMART Domains Protein: ENSMUSP00000139674
Gene: ENSMUSG00000026341

DomainStartEndE-ValueType
ACTIN 1 155 2.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191578
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype Strain: 3765916
Lethality: E3-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. This complex is located at the cell surface and is essential to cell shape and motility through lamellipodial actin assembly and protrusion. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele die prior to E4.5 and exhibit abnormal embryogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(12)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Actr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Actr3 APN 1 125397229 missense probably benign 0.00
IGL00574:Actr3 APN 1 125411274 missense probably damaging 1.00
IGL00715:Actr3 APN 1 125395076 missense probably damaging 0.96
IGL01139:Actr3 APN 1 125405885 missense probably damaging 1.00
IGL01897:Actr3 APN 1 125418288 missense possibly damaging 0.54
P0023:Actr3 UTSW 1 125395066 critical splice donor site probably null
R0217:Actr3 UTSW 1 125407413 splice site probably benign
R0660:Actr3 UTSW 1 125408567 missense probably benign 0.40
R1494:Actr3 UTSW 1 125416281 missense probably benign 0.06
R1582:Actr3 UTSW 1 125405925 missense probably benign 0.01
R1589:Actr3 UTSW 1 125408563 missense probably damaging 1.00
R3432:Actr3 UTSW 1 125394039 missense probably damaging 1.00
R6089:Actr3 UTSW 1 125407395 missense probably damaging 1.00
R6276:Actr3 UTSW 1 125395137 missense probably benign
R7120:Actr3 UTSW 1 125403432 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCGAGATATGGTTTTAAACTGGC -3'
(R):5'- ATCCCTGAGATGAAGCTGAGG -3'

Sequencing Primer
(F):5'- TCTATGAACTCAAGAGCAGCCTGG -3'
(R):5'- CCCTGAGATGAAGCTGAGGTATGG -3'
Posted On2017-12-01