Incidental Mutation 'R5810:Spg7'
ID447472
Institutional Source Beutler Lab
Gene Symbol Spg7
Ensembl Gene ENSMUSG00000000738
Gene NameSPG7, paraplegin matrix AAA peptidase subunit
SynonymsCmar, paraplegin
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123062942-123097760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123094569 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 678 (E678K)
Ref Sequence ENSEMBL: ENSMUSP00000119552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108868] [ENSMUST00000125975] [ENSMUST00000127664] [ENSMUST00000135991] [ENSMUST00000149248] [ENSMUST00000153285]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108868
AA Change: E678K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104496
Gene: ENSMUSG00000000738
AA Change: E678K

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 5.2e-12 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 541 746 1.8e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125975
AA Change: E573K

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120361
Gene: ENSMUSG00000000738
AA Change: E573K

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Pfam:FtsH_ext 37 137 8.5e-12 PFAM
transmembrane domain 145 167 N/A INTRINSIC
AAA 236 376 1.96e-19 SMART
Pfam:Peptidase_M41 436 641 9.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128234
SMART Domains Protein: ENSMUSP00000120793
Gene: ENSMUSG00000000738

DomainStartEndE-ValueType
Pfam:AAA 1 48 5.8e-10 PFAM
Pfam:Peptidase_M41 110 222 9.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130787
Predicted Effect probably benign
Transcript: ENSMUST00000135991
SMART Domains Protein: ENSMUSP00000118066
Gene: ENSMUSG00000000738

DomainStartEndE-ValueType
Pfam:Peptidase_M41 1 81 2.5e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149248
AA Change: E678K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119552
Gene: ENSMUSG00000000738
AA Change: E678K

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 3.9e-11 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 541 746 7e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152972
Predicted Effect probably benign
Transcript: ENSMUST00000153285
AA Change: E641K

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115039
Gene: ENSMUSG00000000738
AA Change: E641K

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 3.8e-11 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 515 709 2.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212364
Meta Mutation Damage Score 0.1985 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. Mutations in this gene cause autosomal recessive spastic paraplegia 7. Two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice exhibit impaired motor skills, putativley associated with axonal degeneration in the central and peripheral nervous systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Spg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Spg7 APN 8 123076930 missense probably damaging 1.00
IGL01868:Spg7 APN 8 123090236 critical splice donor site probably null
IGL02551:Spg7 APN 8 123076978 missense probably damaging 1.00
IGL02744:Spg7 APN 8 123093661 missense probably damaging 1.00
IGL03161:Spg7 APN 8 123087331 missense probably damaging 1.00
IGL03165:Spg7 APN 8 123080812 critical splice donor site probably null
R0729:Spg7 UTSW 8 123070417 missense probably damaging 0.96
R1580:Spg7 UTSW 8 123090238 unclassified probably benign
R1696:Spg7 UTSW 8 123090225 missense probably benign 0.05
R1909:Spg7 UTSW 8 123080741 missense probably benign 0.01
R3751:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3753:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3921:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3976:Spg7 UTSW 8 123079448 missense probably damaging 1.00
R4908:Spg7 UTSW 8 123080655 missense probably damaging 1.00
R4952:Spg7 UTSW 8 123090171 missense probably damaging 1.00
R5392:Spg7 UTSW 8 123087363 missense probably damaging 1.00
R5637:Spg7 UTSW 8 123094575 missense possibly damaging 0.82
R5684:Spg7 UTSW 8 123073884 missense probably damaging 1.00
R6452:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6453:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6454:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6750:Spg7 UTSW 8 123073911 missense probably damaging 1.00
R7090:Spg7 UTSW 8 123091752 critical splice donor site probably null
R7213:Spg7 UTSW 8 123090232 missense probably damaging 1.00
R7705:Spg7 UTSW 8 123073878 missense possibly damaging 0.63
R7811:Spg7 UTSW 8 123097425 missense possibly damaging 0.89
R7863:Spg7 UTSW 8 123089049 critical splice donor site probably null
R8375:Spg7 UTSW 8 123073829 missense probably damaging 0.99
Z1177:Spg7 UTSW 8 123090223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCTTGGACTGTGACAGG -3'
(R):5'- TTGGACCCATTCAGGAGAACAC -3'

Sequencing Primer
(F):5'- CTTGGACTGTGACAGGGCCTG -3'
(R):5'- TTCAGGAGAACACACTACACAGGATG -3'
Posted On2016-12-15