Incidental Mutation 'R5810:Olfr381'
ID447478
Institutional Source Beutler Lab
Gene Symbol Olfr381
Ensembl Gene ENSMUSG00000072708
Gene Nameolfactory receptor 381
SynonymsGA_x6K02T2P1NL-3646409-3645474, MOR135-4
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73484274-73491603 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 73486095 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 243 (S243*)
Ref Sequence ENSEMBL: ENSMUSP00000149355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078358] [ENSMUST00000119863] [ENSMUST00000214623] [ENSMUST00000215358]
Predicted Effect probably null
Transcript: ENSMUST00000078358
AA Change: S243*
SMART Domains Protein: ENSMUSP00000077467
Gene: ENSMUSG00000072708
AA Change: S243*

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 1.3e-35 PFAM
Pfam:7tm_4 139 283 5.3e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119863
AA Change: S243*
SMART Domains Protein: ENSMUSP00000113846
Gene: ENSMUSG00000072708
AA Change: S243*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-57 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206673
Predicted Effect probably null
Transcript: ENSMUST00000214623
AA Change: S243*
Predicted Effect probably null
Transcript: ENSMUST00000215358
AA Change: S243*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Olfr381
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Olfr381 APN 11 73486572 missense probably benign 0.22
IGL02867:Olfr381 APN 11 73485991 missense probably damaging 1.00
IGL03202:Olfr381 APN 11 73486525 nonsense probably null
R0207:Olfr381 UTSW 11 73486575 missense probably benign 0.00
R0539:Olfr381 UTSW 11 73486063 missense probably benign 0.22
R1469:Olfr381 UTSW 11 73486323 missense possibly damaging 0.81
R1469:Olfr381 UTSW 11 73486323 missense possibly damaging 0.81
R1835:Olfr381 UTSW 11 73486374 missense probably benign 0.08
R2095:Olfr381 UTSW 11 73486594 missense probably damaging 1.00
R3612:Olfr381 UTSW 11 73485940 missense probably benign 0.23
R3983:Olfr381 UTSW 11 73486135 missense possibly damaging 0.84
R4959:Olfr381 UTSW 11 73486067 nonsense probably null
R4983:Olfr381 UTSW 11 73486797 missense probably benign 0.04
R5297:Olfr381 UTSW 11 73486389 missense probably damaging 0.99
R5447:Olfr381 UTSW 11 73486176 missense probably benign 0.01
R5569:Olfr381 UTSW 11 73486692 missense probably damaging 0.97
R5580:Olfr381 UTSW 11 73486210 missense probably benign
R5711:Olfr381 UTSW 11 73486182 missense probably damaging 1.00
R6974:Olfr381 UTSW 11 73486473 missense probably benign 0.00
R7383:Olfr381 UTSW 11 73485889 makesense probably null
R7661:Olfr381 UTSW 11 73486600 missense probably damaging 1.00
R7748:Olfr381 UTSW 11 73486168 missense probably benign 0.03
R7913:Olfr381 UTSW 11 73486398 missense probably benign 0.01
Z1177:Olfr381 UTSW 11 73486153 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ACAAGGGCCTCTTTTATATCTCTG -3'
(R):5'- GTGAGGACAATGTGATCCCTC -3'

Sequencing Primer
(F):5'- CTGTTCCTCAGGCTGTAGATGAAAG -3'
(R):5'- GACATATCTGCACTGCTCAAGTTGG -3'
Posted On2016-12-15