Incidental Mutation 'R0549:Kif2b'
ID45033
Institutional Source Beutler Lab
Gene Symbol Kif2b
Ensembl Gene ENSMUSG00000046755
Gene Namekinesin family member 2B
Synonyms1700063D03Rik
MMRRC Submission 038741-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock #R0549 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location91575315-91577558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91576584 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 291 (I291N)
Ref Sequence ENSEMBL: ENSMUSP00000058084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061019]
Predicted Effect probably damaging
Transcript: ENSMUST00000061019
AA Change: I291N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058084
Gene: ENSMUSG00000046755
AA Change: I291N

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
KISc 211 549 2.34e-134 SMART
low complexity region 588 603 N/A INTRINSIC
coiled coil region 640 664 N/A INTRINSIC
Meta Mutation Damage Score 0.5332 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,322,290 F498L probably damaging Het
Adamts6 A T 13: 104,297,255 D64V possibly damaging Het
Agbl2 T C 2: 90,789,843 probably benign Het
Angptl3 A G 4: 99,031,455 S151G probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
C4b G T 17: 34,735,415 L927I probably damaging Het
Ccl3 T C 11: 83,648,336 T66A probably damaging Het
Cdh7 T C 1: 110,108,944 L618P probably damaging Het
Cfap65 T C 1: 74,918,444 T989A probably benign Het
Cnpy4 T C 5: 138,187,637 F18S possibly damaging Het
Col6a5 A G 9: 105,904,579 probably benign Het
Dppa2 G A 16: 48,318,671 R289H probably benign Het
Evx2 T C 2: 74,659,134 T96A probably benign Het
Frmd4a A G 2: 4,603,967 E577G possibly damaging Het
Gcgr G A 11: 120,536,561 G166S probably benign Het
Gm4788 A T 1: 139,739,488 D377E probably damaging Het
Gm5316 T C 6: 122,900,191 noncoding transcript Het
Gria1 G A 11: 57,228,973 R292Q probably damaging Het
Hars2 T A 18: 36,786,208 probably null Het
Hkdc1 T A 10: 62,400,240 T508S probably benign Het
Lmbrd1 A T 1: 24,744,920 T377S probably benign Het
Lrrc28 A G 7: 67,628,342 probably benign Het
Mmp3 A T 9: 7,455,638 N463I probably benign Het
Myh6 A G 14: 54,958,608 F578S probably damaging Het
Ncbp1 T A 4: 46,168,476 M608K possibly damaging Het
Nf1 T C 11: 79,468,771 F1412L probably damaging Het
Nlrp5 T A 7: 23,441,802 W1083R probably damaging Het
Nrsn1 T C 13: 25,262,258 Y45C probably benign Het
Olfr401 T G 11: 74,121,475 M62R probably damaging Het
Osbpl7 G T 11: 97,067,542 R881L probably damaging Het
Papss1 A G 3: 131,619,213 E456G possibly damaging Het
Pbxip1 T A 3: 89,443,592 probably benign Het
Pcca A G 14: 122,638,377 probably benign Het
Pde1a T A 2: 79,865,070 N511I probably damaging Het
Prpf39 A T 12: 65,056,256 I435F probably benign Het
Rnf213 C T 11: 119,465,082 T4117M probably damaging Het
Sel1l2 A T 2: 140,265,882 M216K probably damaging Het
Sidt2 A G 9: 45,953,119 probably null Het
Sirt3 A T 7: 140,869,487 probably null Het
Smpd4 T C 16: 17,639,312 V378A probably benign Het
Svil T A 18: 5,064,566 S642T possibly damaging Het
Tcp10a A G 17: 7,326,551 K92E probably benign Het
Tmem144 T C 3: 79,822,744 D233G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnik T C 3: 28,570,920 S335P possibly damaging Het
Ush2a T C 1: 188,946,953 L4786P probably damaging Het
Utp11 A T 4: 124,686,079 probably benign Het
Vmn1r67 A G 7: 10,447,714 N241D probably damaging Het
Vmn2r11 A T 5: 109,052,097 C497S possibly damaging Het
Other mutations in Kif2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Kif2b APN 11 91576380 missense probably damaging 1.00
IGL01459:Kif2b APN 11 91577023 missense possibly damaging 0.65
IGL01468:Kif2b APN 11 91576365 missense probably damaging 1.00
IGL02897:Kif2b APN 11 91576219 missense probably damaging 1.00
R0076:Kif2b UTSW 11 91575909 missense probably damaging 1.00
R0488:Kif2b UTSW 11 91576972 missense probably benign 0.00
R0524:Kif2b UTSW 11 91575724 missense probably benign 0.00
R0893:Kif2b UTSW 11 91575594 missense probably benign 0.16
R1677:Kif2b UTSW 11 91575972 missense probably damaging 1.00
R2025:Kif2b UTSW 11 91577346 missense probably damaging 0.99
R2185:Kif2b UTSW 11 91576971 frame shift probably null
R2290:Kif2b UTSW 11 91575696 missense probably benign 0.00
R4697:Kif2b UTSW 11 91576846 missense probably benign 0.01
R4785:Kif2b UTSW 11 91576428 missense probably benign 0.07
R5429:Kif2b UTSW 11 91577229 missense probably benign 0.03
R5555:Kif2b UTSW 11 91575460 missense probably benign 0.00
R5652:Kif2b UTSW 11 91575830 missense possibly damaging 0.86
R5765:Kif2b UTSW 11 91577242 missense probably benign 0.28
R6101:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6105:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6450:Kif2b UTSW 11 91576366 missense probably damaging 0.99
R6862:Kif2b UTSW 11 91575915 missense probably damaging 1.00
R7097:Kif2b UTSW 11 91576824 missense probably benign 0.00
R7189:Kif2b UTSW 11 91577137 missense probably benign 0.01
R7507:Kif2b UTSW 11 91577443 missense probably benign
R7742:Kif2b UTSW 11 91576585 missense possibly damaging 0.85
R7818:Kif2b UTSW 11 91576126 missense probably damaging 1.00
R7820:Kif2b UTSW 11 91577274 missense probably benign 0.01
R7946:Kif2b UTSW 11 91575745 missense probably benign 0.00
R8378:Kif2b UTSW 11 91576375 missense possibly damaging 0.95
R8442:Kif2b UTSW 11 91576314 missense possibly damaging 0.54
Z1176:Kif2b UTSW 11 91576264 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAACAGATCGTACACTTTGCCACC -3'
(R):5'- CTAGATAGCAGCAAGATGTCCAGCC -3'

Sequencing Primer
(F):5'- AAGGTCCCATAGACTTTGAGTTCC -3'
(R):5'- GTGAGAAAGCGCCCTCTTAATC -3'
Posted On2013-06-11