Mutagenetix > Incidental Mutation

Incidental Mutation 'R5056:Usp32'

390864

Institutional Source

Beutler Lab

Gene Symbol

Usp32

Ensembl Gene

ENSMUSG00000000804

Gene Name

ubiquitin specific peptidase 32

Synonyms

6430526O11Rik, 2900074J03Rik

MMRRC Submission

042646-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5056 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84984442-85140161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85026795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 802 (V802A)

Ref Sequence

ENSEMBL: ENSMUSP00000103710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108075]

AlphaFold

F8VPZ3

Predicted Effect

unknown
Transcript: ENSMUST00000000821
AA Change: V100A

SMART Domains

Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804
AA Change: V100A

Domain	Start	End	E-Value	Type
Pfam:UCH	32	260	4.1e-51	PFAM
Pfam:UCH_1	33	228	1.7e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108075
AA Change: V802A

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: V802A

Domain	Start	End	E-Value	Type
EFh	232	260	4.66e0	SMART
EFh	268	296	5.8e-1	SMART
Blast:EFh	318	346	5e-7	BLAST
DUSP	389	588	2.32e-16	SMART
Pfam:Ubiquitin_3	628	711	2.4e-9	PFAM
Pfam:UCH	733	1564	2.4e-83	PFAM
Pfam:UCH_1	1202	1547	2.9e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174602

SMART Domains

Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
Pfam:DUSP	1	65	6.5e-17	PFAM
Pfam:Ubiquitin_3	122	216	8e-10	PFAM
Pfam:UCH	238	257	1.2e-7	PFAM

Meta Mutation Damage Score

0.4926

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.2%

Validation Efficiency

99% (73/74)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030J22Rik	T	A	8: 116,971,682	K229*	probably null	Het
9930021J03Rik	A	T	19: 29,717,359	I1578K	probably benign	Het
Adora2a	T	A	10: 75,326,158	S44T	probably damaging	Het
Agap3	T	C	5: 24,477,862	V459A	probably damaging	Het
Apc2	T	C	10: 80,301,314	V31A	probably benign	Het
Asic2	T	A	11: 80,971,603	K189N	possibly damaging	Het
Bbs10	C	T	10: 111,300,540	P505S	probably benign	Het
C87414	T	C	5: 93,638,925		probably benign	Het
Cdh20	G	T	1: 104,953,997	V396L	probably benign	Het
Cenpb	C	T	2: 131,178,171		probably benign	Het
Chil6	T	A	3: 106,394,343	Y147F	probably damaging	Het
Cluh	C	T	11: 74,661,946	R606C	probably damaging	Het
Cmtr1	A	G	17: 29,690,328	T404A	possibly damaging	Het
Cnot1	T	C	8: 95,741,008	N1499S	probably damaging	Het
Dmkn	T	C	7: 30,764,104	S61P	probably damaging	Het
Dmxl1	T	C	18: 49,870,923	C872R	probably benign	Het
Dnah3	A	G	7: 120,020,946	Y1587H	probably damaging	Het
Dsc2	A	T	18: 20,050,142	V73D	probably damaging	Het
F5	A	T	1: 164,192,032	Y692F	possibly damaging	Het
Fam184a	A	T	10: 53,674,574	L80I	probably damaging	Het
Fam46b	C	T	4: 133,480,438	R47W	possibly damaging	Het
Foxj2	A	G	6: 122,833,874	H271R	probably benign	Het
Grm7	A	G	6: 111,080,443	T335A	probably damaging	Het
Hspa9	A	G	18: 34,938,681	L622P	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kcnd3	T	A	3: 105,666,928		probably benign	Het
Klhdc8b	ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC	ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC	9: 108,448,985		probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrch4	C	G	5: 137,636,851	N237K	probably damaging	Het
Lss	T	G	10: 76,552,926		probably null	Het
Map6	T	C	7: 99,336,652	F588L	probably benign	Het
Mbd6	C	T	10: 127,286,441	V173I	probably benign	Het
Med13	A	T	11: 86,328,565	S352T	probably benign	Het
Mettl16	T	A	11: 74,816,940	V320E	probably benign	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nup188	T	A	2: 30,304,131	D149E	probably damaging	Het
Ogfrl1	A	G	1: 23,379,049	S83P	probably damaging	Het
Olfr1025-ps1	T	A	2: 85,918,136	D70E	probably damaging	Het
Olfr1083-ps	T	A	2: 86,607,020	I184F	unknown	Het
Olfr1154	T	C	2: 87,903,571	Y35C	probably damaging	Het
Olfr685	T	A	7: 105,180,572	H262L	probably damaging	Het
Pafah1b3	C	T	7: 25,295,339	R98Q	probably damaging	Het
Pde6b	A	T	5: 108,423,491	K437*	probably null	Het
Ppp1r12b	A	T	1: 134,834,392		probably benign	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Prdm9	T	C	17: 15,562,417	Q104R	possibly damaging	Het
Rgs22	A	T	15: 36,050,245		probably null	Het
Rnf14	C	T	18: 38,308,388	P277L	probably damaging	Het
Robo4	T	C	9: 37,404,806	S258P	probably benign	Het
Sfrp1	T	A	8: 23,417,404	F207I	probably damaging	Het
Sgms1	A	G	19: 32,159,687	S160P	probably damaging	Het
Sil1	T	C	18: 35,269,702	K263R	probably benign	Het
St14	A	G	9: 31,097,551		probably null	Het
Syne2	A	G	12: 75,909,131		probably benign	Het
Tbc1d9	T	C	8: 83,269,206	S1013P	probably benign	Het
Tmem67	T	C	4: 12,070,471	S352G	probably benign	Het
Trib2	C	A	12: 15,793,794	K282N	possibly damaging	Het
Trnau1ap	T	C	4: 132,327,171		probably benign	Het
Trpm4	T	C	7: 45,308,630	D952G	probably damaging	Het
Unc93b1	A	G	19: 3,942,762	N305D	possibly damaging	Het
Vmn2r48	T	A	7: 9,942,324	H410L	probably damaging	Het
Wfs1	T	C	5: 36,975,587	N116S	probably benign	Het
Wif1	A	T	10: 121,099,779	H333L	probably benign	Het
Zfp109	T	C	7: 24,228,737	T416A	possibly damaging	Het
Zfp808	T	A	13: 62,172,630	C558S	probably damaging	Het
Zpbp	T	C	11: 11,459,734	D116G	possibly damaging	Het

Other mutations in Usp32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00529:Usp32	APN	11	84994426	missense	probably damaging	1.00
IGL00701:Usp32	APN	11	85059125	splice site	probably null
IGL00848:Usp32	APN	11	85051181	splice site	probably benign
IGL00934:Usp32	APN	11	85007076	missense	probably damaging	1.00
IGL01019:Usp32	APN	11	85039265	missense	probably damaging	0.97
IGL01302:Usp32	APN	11	84988482	missense	probably benign	0.05
IGL01444:Usp32	APN	11	85059164	missense	probably damaging	0.97
IGL01575:Usp32	APN	11	85022802	missense	probably damaging	1.00
IGL01981:Usp32	APN	11	85036524	missense	probably benign	0.02
IGL02118:Usp32	APN	11	85032177	nonsense	probably null
IGL02159:Usp32	APN	11	85005802	splice site	probably null
IGL02227:Usp32	APN	11	84986481	missense	probably damaging	1.00
IGL02363:Usp32	APN	11	85044787	missense	probably benign	0.01
IGL02524:Usp32	APN	11	85010011	nonsense	probably null
IGL02613:Usp32	APN	11	85040070	missense	probably damaging	0.99
IGL02720:Usp32	APN	11	85006991	critical splice donor site	probably null
IGL02738:Usp32	APN	11	85083806	missense	probably damaging	1.00
IGL02929:Usp32	APN	11	84988372	missense	probably benign	0.01
IGL03303:Usp32	APN	11	85022832	missense	probably damaging	1.00
BB010:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
BB020:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
PIT4812001:Usp32	UTSW	11	85010074	missense	probably damaging	1.00
R0026:Usp32	UTSW	11	85032074	missense	possibly damaging	0.48
R0295:Usp32	UTSW	11	85053692	missense	probably damaging	0.98
R1320:Usp32	UTSW	11	85017793	missense	probably damaging	0.98
R1712:Usp32	UTSW	11	85042580	missense	probably benign	0.12
R1922:Usp32	UTSW	11	85007004	nonsense	probably null
R1973:Usp32	UTSW	11	85103931	missense	probably benign	0.09
R2010:Usp32	UTSW	11	85040004	missense	probably damaging	0.98
R2082:Usp32	UTSW	11	85030512	missense	probably damaging	0.99
R2355:Usp32	UTSW	11	85005909	missense	probably benign	0.34
R3147:Usp32	UTSW	11	85029087	missense	probably damaging	1.00
R3160:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3162:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3716:Usp32	UTSW	11	85042563	missense	probably damaging	1.00
R3816:Usp32	UTSW	11	84994384	critical splice donor site	probably null
R3870:Usp32	UTSW	11	85007055	nonsense	probably null
R3871:Usp32	UTSW	11	85081156	missense	probably null	0.81
R4041:Usp32	UTSW	11	85017739	missense	probably benign	0.40
R4079:Usp32	UTSW	11	85039229	missense	probably damaging	0.98
R4332:Usp32	UTSW	11	85103978	missense	possibly damaging	0.79
R4396:Usp32	UTSW	11	85053975	missense	probably benign
R4580:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4620:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4744:Usp32	UTSW	11	84994393	missense	probably damaging	1.00
R4909:Usp32	UTSW	11	85055772	nonsense	probably null
R5111:Usp32	UTSW	11	85077331	missense	possibly damaging	0.95
R5213:Usp32	UTSW	11	85022259	missense	probably damaging	1.00
R5308:Usp32	UTSW	11	85017718	missense	probably benign	0.12
R5381:Usp32	UTSW	11	85059127	critical splice donor site	probably benign
R5538:Usp32	UTSW	11	85017786	missense	possibly damaging	0.65
R5659:Usp32	UTSW	11	85077414	missense	possibly damaging	0.94
R6006:Usp32	UTSW	11	84992451	critical splice donor site	probably null
R6011:Usp32	UTSW	11	85032097	missense	possibly damaging	0.70
R6029:Usp32	UTSW	11	85025582	missense	probably damaging	0.99
R6074:Usp32	UTSW	11	84994573	missense	probably benign	0.00
R6331:Usp32	UTSW	11	84986576	missense	possibly damaging	0.92
R6353:Usp32	UTSW	11	85022281	missense	probably benign
R6714:Usp32	UTSW	11	85026870	missense	probably damaging	0.99
R6778:Usp32	UTSW	11	85025686	missense	probably benign	0.00
R6988:Usp32	UTSW	11	85010143	missense	probably benign	0.35
R6992:Usp32	UTSW	11	85032088	missense	probably damaging	0.99
R7182:Usp32	UTSW	11	85040170	missense	probably benign	0.34
R7186:Usp32	UTSW	11	85051234	missense	probably benign	0.45
R7198:Usp32	UTSW	11	85022855	frame shift	probably null
R7201:Usp32	UTSW	11	85022855	frame shift	probably null
R7469:Usp32	UTSW	11	84988553	missense	possibly damaging	0.94
R7502:Usp32	UTSW	11	85022898	missense	possibly damaging	0.48
R7513:Usp32	UTSW	11	85027112	nonsense	probably null
R7629:Usp32	UTSW	11	85019855	frame shift	probably null
R7703:Usp32	UTSW	11	85077327	missense	probably damaging	0.99
R7741:Usp32	UTSW	11	84987281	missense	probably damaging	0.99
R7765:Usp32	UTSW	11	84994408	missense	probably damaging	1.00
R7933:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
R7973:Usp32	UTSW	11	85022808	missense	probably damaging	0.99
R7989:Usp32	UTSW	11	85034300	missense
R7998:Usp32	UTSW	11	84994426	missense	probably damaging	1.00
R8292:Usp32	UTSW	11	85077401	missense	probably damaging	0.99
R8305:Usp32	UTSW	11	85032185	missense	possibly damaging	0.83
R8548:Usp32	UTSW	11	85017827	missense	possibly damaging	0.52
R8924:Usp32	UTSW	11	85025544	missense	probably damaging	0.98
R9002:Usp32	UTSW	11	85053951	missense	probably damaging	0.96
R9145:Usp32	UTSW	11	85022292	missense	probably damaging	1.00
R9209:Usp32	UTSW	11	85040012	missense	probably damaging	0.98
R9211:Usp32	UTSW	11	85022733	missense	probably damaging	1.00
R9296:Usp32	UTSW	11	85017652	missense	probably damaging	1.00
R9310:Usp32	UTSW	11	85051202	missense	probably benign	0.29
R9417:Usp32	UTSW	11	84994543	missense	probably damaging	1.00
R9514:Usp32	UTSW	11	85022734	missense	probably damaging	0.99
R9652:Usp32	UTSW	11	85030491	missense	probably damaging	0.97
R9723:Usp32	UTSW	11	85044710	nonsense	probably null
R9757:Usp32	UTSW	11	85077329	nonsense	probably null
X0028:Usp32	UTSW	11	84992606	missense	probably benign	0.05
Z1177:Usp32	UTSW	11	84988612	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTTAGCAATGCTAGTAGTCAAAGAG -3'
(R):5'- ATGGAATAAGGGCCTATCTCTTG -3'

Sequencing Primer
(F):5'- GGGTTTACTCTTCTTACAAGAAAAGC -3'
(R):5'- CTCTTGATAGGTAGTTTTGTGCCCAC -3'

Posted On

2016-06-06