Incidental Mutation 'R5700:Klhl1'
ID450864
Institutional Source Beutler Lab
Gene Symbol Klhl1
Ensembl Gene ENSMUSG00000022076
Gene Namekelch-like 1
Synonyms
MMRRC Submission 043328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5700 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location96102736-96519102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96518040 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 93 (N93S)
Ref Sequence ENSEMBL: ENSMUSP00000022666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022666]
Predicted Effect probably benign
Transcript: ENSMUST00000022666
AA Change: N93S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022666
Gene: ENSMUSG00000022076
AA Change: N93S

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
BTB 215 312 1.13e-28 SMART
BACK 317 418 5.03e-34 SMART
Kelch 463 509 8.86e-10 SMART
Kelch 510 556 1.04e-15 SMART
Kelch 557 603 6.76e-15 SMART
Kelch 604 650 2.23e-15 SMART
Kelch 651 703 3.09e-9 SMART
Kelch 704 750 3.43e-16 SMART
Meta Mutation Damage Score 0.0657 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The KLHL1 protein belongs to a family of actin-organizing proteins related to Drosophila Kelch (Nemes et al., 2000 [PubMed 10888605]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice both homozygous and heterozygous for disruption of this gene develop abnormalities in gait and defects in motor coordination with time. Dendritic atrophy of Purkinje cells is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,798,194 Q155L probably benign Het
Acadvl A C 11: 70,013,203 Y242D probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Barx2 A T 9: 31,858,765 F156I probably damaging Het
Best1 T C 19: 9,997,199 probably benign Het
Btbd8 T C 5: 107,503,648 S136P possibly damaging Het
Btla T A 16: 45,250,573 Y298* probably null Het
Casr T A 16: 36,509,617 I452F probably damaging Het
Ccser1 C A 6: 61,311,276 P141H probably benign Het
Cr2 A G 1: 195,159,757 V296A probably damaging Het
Csl T A 10: 99,759,015 I63F probably damaging Het
Dbt G A 3: 116,520,303 V40M probably damaging Het
Fam53b A T 7: 132,760,020 L93Q probably damaging Het
Fdps T C 3: 89,095,649 I105V probably damaging Het
Gm4884 A G 7: 41,043,219 D204G probably benign Het
Gm5592 A G 7: 41,158,579 probably benign Het
Gm7367 A T 7: 60,155,762 noncoding transcript Het
Grid2 T A 6: 64,094,432 V413D possibly damaging Het
Hgf C T 5: 16,610,124 P471L probably damaging Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Hs6st3 C T 14: 119,138,787 R125* probably null Het
Kdm4b T C 17: 56,351,700 I15T possibly damaging Het
Klhl6 G A 16: 19,957,218 Q197* probably null Het
Medag T C 5: 149,422,217 V7A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nckap5 C T 1: 125,976,925 probably null Het
Obscn T C 11: 59,133,194 K550R probably benign Het
Olfr1369-ps1 T A 13: 21,116,001 V103E probably damaging Het
Olfr193 T A 16: 59,109,993 I206F probably damaging Het
Olfr716 A G 7: 107,147,541 N75S probably benign Het
Olfr8 T C 10: 78,955,484 I93T probably damaging Het
Parp6 T C 9: 59,624,727 S101P probably damaging Het
Plcd3 T C 11: 103,073,763 N594S probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Ppp2r1b T C 9: 50,878,157 Y443H probably damaging Het
Pqlc2 C T 4: 139,300,254 S259N probably damaging Het
Prnd G A 2: 131,953,343 V128I probably benign Het
Rftn1 G T 17: 50,002,669 P156Q probably damaging Het
Scmh1 T C 4: 120,516,946 V445A probably benign Het
Serpinb6c A T 13: 33,899,308 M41K probably damaging Het
Spns1 A G 7: 126,372,469 V303A possibly damaging Het
Ston1 T A 17: 88,644,339 S639R probably damaging Het
Thbs4 T C 13: 92,776,953 D153G probably benign Het
Timm44 T C 8: 4,274,171 Y36C probably damaging Het
Trim34b G T 7: 104,336,411 V418F probably damaging Het
Vmn1r72 C T 7: 11,670,423 V33M probably damaging Het
Zcchc7 T C 4: 44,931,084 V412A probably benign Het
Zfand1 T A 3: 10,341,019 N210I probably damaging Het
Zfhx3 A G 8: 108,933,867 H1251R probably damaging Het
Other mutations in Klhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01573:Klhl1 APN 14 96201204 splice site probably benign
IGL02055:Klhl1 APN 14 96280103 missense possibly damaging 0.96
IGL02110:Klhl1 APN 14 96136603 missense probably benign 0.27
IGL02216:Klhl1 APN 14 96123222 missense probably benign 0.08
IGL02307:Klhl1 APN 14 96201373 missense possibly damaging 0.68
IGL02538:Klhl1 APN 14 96240213 missense probably benign 0.03
IGL02559:Klhl1 APN 14 96151960 missense possibly damaging 0.95
IGL02682:Klhl1 APN 14 96201342 missense possibly damaging 0.83
IGL03228:Klhl1 APN 14 96240327 missense probably damaging 1.00
LCD18:Klhl1 UTSW 14 96317730 intron probably benign
P0041:Klhl1 UTSW 14 96280211 missense probably damaging 1.00
R0270:Klhl1 UTSW 14 96518344 start gained probably benign
R0419:Klhl1 UTSW 14 96381789 missense probably benign 0.30
R0938:Klhl1 UTSW 14 96152040 nonsense probably null
R1465:Klhl1 UTSW 14 96240213 missense probably benign 0.03
R1465:Klhl1 UTSW 14 96240213 missense probably benign 0.03
R1590:Klhl1 UTSW 14 96368636 missense probably damaging 1.00
R1597:Klhl1 UTSW 14 96201211 critical splice donor site probably null
R1893:Klhl1 UTSW 14 96240206 critical splice donor site probably null
R1928:Klhl1 UTSW 14 96346789 missense probably benign 0.02
R2272:Klhl1 UTSW 14 96517908 missense probably benign 0.00
R3612:Klhl1 UTSW 14 96381770 critical splice donor site probably null
R3852:Klhl1 UTSW 14 96280205 missense probably benign 0.12
R3872:Klhl1 UTSW 14 96518179 missense probably benign 0.03
R3874:Klhl1 UTSW 14 96518179 missense probably benign 0.03
R3923:Klhl1 UTSW 14 96346880 missense possibly damaging 0.46
R3925:Klhl1 UTSW 14 96346880 missense possibly damaging 0.46
R3926:Klhl1 UTSW 14 96346880 missense possibly damaging 0.46
R4151:Klhl1 UTSW 14 96518316 start codon destroyed probably null 0.73
R4502:Klhl1 UTSW 14 96517846 missense probably benign
R4536:Klhl1 UTSW 14 96136583 critical splice donor site probably null
R4729:Klhl1 UTSW 14 96280148 missense probably damaging 1.00
R4756:Klhl1 UTSW 14 96151966 missense probably benign 0.39
R5001:Klhl1 UTSW 14 96136610 missense probably damaging 0.96
R5022:Klhl1 UTSW 14 96136706 missense probably benign 0.31
R5616:Klhl1 UTSW 14 96518293 missense probably benign 0.44
R5634:Klhl1 UTSW 14 96240271 missense probably damaging 0.96
R5701:Klhl1 UTSW 14 96201380 missense probably benign
R5934:Klhl1 UTSW 14 96123215 critical splice donor site probably null
R5950:Klhl1 UTSW 14 96240354 missense probably damaging 0.99
R6454:Klhl1 UTSW 14 96280091 missense possibly damaging 0.66
R6496:Klhl1 UTSW 14 96240216 missense probably benign 0.03
R6606:Klhl1 UTSW 14 96123222 missense possibly damaging 0.52
R6644:Klhl1 UTSW 14 96517918 missense probably benign
R6745:Klhl1 UTSW 14 96280002 critical splice donor site probably null
R6919:Klhl1 UTSW 14 96136594 missense probably benign 0.00
R7029:Klhl1 UTSW 14 96518196 missense probably benign 0.01
R7195:Klhl1 UTSW 14 96280077 missense probably benign 0.08
R7467:Klhl1 UTSW 14 96123277 missense probably damaging 1.00
R7483:Klhl1 UTSW 14 96346868 missense probably benign 0.09
R7650:Klhl1 UTSW 14 96346943 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCTCTTTCAGGGCCAATCC -3'
(R):5'- CTCCGCTGGAAACTCTTCAG -3'

Sequencing Primer
(F):5'- CTTTGTCCTCTGGTCCAGAAAAG -3'
(R):5'- GCTGGAAACTCTTCAGCCATC -3'
Posted On2017-01-03