Incidental Mutation 'R5042:Gm10719'
ID452806
Institutional Source Beutler Lab
Gene Symbol Gm10719
Ensembl Gene ENSMUSG00000095547
Gene Namepredicted gene 10719
Synonyms
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R5042 (G1)
Quality Score20.1
Status Validated
Chromosome9
Chromosomal Location3017408-3021593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3018970 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 72 (F72I)
Ref Sequence ENSEMBL: ENSMUSP00000136170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099046] [ENSMUST00000099047] [ENSMUST00000099049] [ENSMUST00000099050] [ENSMUST00000143083] [ENSMUST00000179272]
Predicted Effect probably benign
Transcript: ENSMUST00000099046
SMART Domains Protein: ENSMUSP00000096645
Gene: ENSMUSG00000095186

DomainStartEndE-ValueType
internal_repeat_1 1 41 4.44e-7 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 177 4.44e-7 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099047
SMART Domains Protein: ENSMUSP00000096646
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 40 1.58e-10 PROSPERO
transmembrane domain 53 72 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 176 1.58e-10 PROSPERO
transmembrane domain 199 221 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099049
AA Change: F208Y

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096648
Gene: ENSMUSG00000095547
AA Change: F208Y

DomainStartEndE-ValueType
internal_repeat_1 1 46 2.19e-9 PROSPERO
transmembrane domain 62 84 N/A INTRINSIC
internal_repeat_1 117 182 2.19e-9 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099050
SMART Domains Protein: ENSMUSP00000096649
Gene: ENSMUSG00000074564

DomainStartEndE-ValueType
internal_repeat_1 1 46 7.44e-11 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 182 7.44e-11 PROSPERO
transmembrane domain 192 214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143083
SMART Domains Protein: ENSMUSP00000137330
Gene: ENSMUSG00000096519

DomainStartEndE-ValueType
internal_repeat_1 1 19 1.27e-7 PROSPERO
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 135 1.27e-7 PROSPERO
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 192 214 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179272
AA Change: F72I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136170
Gene: ENSMUSG00000095547
AA Change: F72I

DomainStartEndE-ValueType
internal_repeat_1 1 49 2.1e-10 PROSPERO
transmembrane domain 74 96 N/A INTRINSIC
internal_repeat_1 118 186 2.1e-10 PROSPERO
transmembrane domain 198 217 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181572
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Gm10719
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4063:Gm10719 UTSW 9 3019043 missense probably damaging 1.00
R4559:Gm10719 UTSW 9 3018945 missense probably benign 0.17
R4952:Gm10719 UTSW 9 3018962 missense probably benign
R5521:Gm10719 UTSW 9 3018970 missense probably damaging 1.00
R5538:Gm10719 UTSW 9 3018962 missense probably benign
R6215:Gm10719 UTSW 9 3019040 splice site probably null
V5622:Gm10719 UTSW 9 3021253 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGGTCCTACAGTGTGCATTTC -3'
(R):5'- ATCCACTTGACGACGTGAAA -3'

Sequencing Primer
(F):5'- GTCATTGTTCAAGTTGTCAACTGC -3'
(R):5'- CACACTGTAGGACCTGGAATATTGC -3'
Posted On2017-01-06