Incidental Mutation 'R5042:Pcdhga9'
ID393278
Institutional Source Beutler Lab
Gene Symbol Pcdhga9
Ensembl Gene ENSMUSG00000102440
Gene Nameprotocadherin gamma subfamily A, 9
Synonyms
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R5042 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37736936-37841870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37737577 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 153 (Y153C)
Ref Sequence ENSEMBL: ENSMUSP00000089555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003599] [ENSMUST00000066149] [ENSMUST00000073447] [ENSMUST00000091935] [ENSMUST00000115661] [ENSMUST00000192511] [ENSMUST00000192535] [ENSMUST00000192931] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000195112] [ENSMUST00000194544] [ENSMUST00000195363] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000195823]
Predicted Effect probably benign
Transcript: ENSMUST00000003599
SMART Domains Protein: ENSMUSP00000003599
Gene: ENSMUSG00000103088

DomainStartEndE-ValueType
CA 47 131 8.06e-6 SMART
CA 155 240 2.29e-19 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 4.94e-24 SMART
CA 474 560 7.6e-25 SMART
CA 591 672 9.18e-10 SMART
Pfam:Cadherin_C_2 687 768 3.5e-20 PFAM
Pfam:Cadherin_tail 807 930 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066149
SMART Domains Protein: ENSMUSP00000067728
Gene: ENSMUSG00000103897

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 31 131 4.84e-2 SMART
CA 155 240 1.48e-22 SMART
CA 264 345 1.14e-23 SMART
CA 369 450 9.44e-21 SMART
CA 474 560 1.03e-26 SMART
CA 591 669 3.64e-13 SMART
Pfam:Cadherin_C_2 688 772 3e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091935
AA Change: Y153C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089555
Gene: ENSMUSG00000102440
AA Change: Y153C

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 32 132 8.37e-3 SMART
CA 156 241 5.51e-22 SMART
CA 265 346 8.27e-26 SMART
CA 370 451 1.4e-23 SMART
CA 475 561 2.97e-27 SMART
CA 592 670 1.18e-12 SMART
Pfam:Cadherin_C_2 688 772 3.9e-24 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192511
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192535
SMART Domains Protein: ENSMUSP00000142010
Gene: ENSMUSG00000103749

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 8e-3 SMART
CA 155 240 2.49e-20 SMART
CA 264 341 4.97e-29 SMART
CA 365 446 1.09e-25 SMART
CA 470 556 1.75e-24 SMART
CA 587 668 9.18e-10 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193006
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194814
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195363
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Meta Mutation Damage Score 0.2838 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Pcdhga9
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4468001:Pcdhga9 UTSW 18 37739474 nonsense probably null
R2870:Pcdhga9 UTSW 18 37737471 missense possibly damaging 0.93
R2870:Pcdhga9 UTSW 18 37737471 missense possibly damaging 0.93
R2871:Pcdhga9 UTSW 18 37737471 missense possibly damaging 0.93
R2871:Pcdhga9 UTSW 18 37737471 missense possibly damaging 0.93
R2872:Pcdhga9 UTSW 18 37737471 missense possibly damaging 0.93
R2872:Pcdhga9 UTSW 18 37737471 missense possibly damaging 0.93
R2873:Pcdhga9 UTSW 18 37737471 missense possibly damaging 0.93
R3727:Pcdhga9 UTSW 18 37738942 missense probably benign 0.03
R3918:Pcdhga9 UTSW 18 37738942 missense probably benign 0.03
R3939:Pcdhga9 UTSW 18 37738942 missense probably benign 0.03
R3940:Pcdhga9 UTSW 18 37738942 missense probably benign 0.03
R3946:Pcdhga9 UTSW 18 37737844 missense probably damaging 1.00
R4397:Pcdhga9 UTSW 18 37738641 missense probably damaging 1.00
R4576:Pcdhga9 UTSW 18 37737828 missense probably damaging 1.00
R4617:Pcdhga9 UTSW 18 37738500 missense probably damaging 1.00
R4810:Pcdhga9 UTSW 18 37738548 missense possibly damaging 0.95
R4903:Pcdhga9 UTSW 18 37739005 missense probably damaging 1.00
R4941:Pcdhga9 UTSW 18 37738132 missense probably damaging 0.99
R5641:Pcdhga9 UTSW 18 37738248 missense probably damaging 1.00
R5743:Pcdhga9 UTSW 18 37738806 missense probably damaging 1.00
R6762:Pcdhga9 UTSW 18 37737268 missense probably damaging 1.00
R7140:Pcdhga9 UTSW 18 37739131 missense possibly damaging 0.67
R7619:Pcdhga9 UTSW 18 37738752 missense probably damaging 1.00
R7804:Pcdhga9 UTSW 18 37738079 missense probably damaging 1.00
R8088:Pcdhga9 UTSW 18 37736954 intron probably benign
R8506:Pcdhga9 UTSW 18 37738684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACCCAGCTTTTCTCTCTGAG -3'
(R):5'- AACACTGTGACCTGGATGAGC -3'

Sequencing Primer
(F):5'- TTCTCTCTGAGTCCGCGGAG -3'
(R):5'- ACCTGGATGAGCGCTGTG -3'
Posted On2016-06-15