Incidental Mutation 'R5042:Wasf2'
ID393244
Institutional Source Beutler Lab
Gene Symbol Wasf2
Ensembl Gene ENSMUSG00000028868
Gene NameWAS protein family, member 2
SynonymsD4Ertd13e, WAVE2
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5042 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location133130505-133199756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133176564 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 28 (R28W)
Ref Sequence ENSEMBL: ENSMUSP00000117314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084241] [ENSMUST00000105912] [ENSMUST00000138831]
Predicted Effect unknown
Transcript: ENSMUST00000084241
AA Change: R28W
SMART Domains Protein: ENSMUSP00000081263
Gene: ENSMUSG00000028868
AA Change: R28W

DomainStartEndE-ValueType
PDB:4N78|D 1 219 4e-90 PDB
low complexity region 243 263 N/A INTRINSIC
low complexity region 293 403 N/A INTRINSIC
low complexity region 411 419 N/A INTRINSIC
WH2 435 452 7.02e-5 SMART
low complexity region 481 497 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105912
AA Change: R28W
SMART Domains Protein: ENSMUSP00000101532
Gene: ENSMUSG00000028868
AA Change: R28W

DomainStartEndE-ValueType
PDB:4N78|D 1 219 4e-90 PDB
low complexity region 243 263 N/A INTRINSIC
low complexity region 293 403 N/A INTRINSIC
low complexity region 411 419 N/A INTRINSIC
WH2 435 452 7.02e-5 SMART
low complexity region 481 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136132
Predicted Effect probably benign
Transcript: ENSMUST00000138831
AA Change: R28W

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117314
Gene: ENSMUSG00000028868
AA Change: R28W

DomainStartEndE-ValueType
PDB:3P8C|D 1 85 6e-36 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158673
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Wiskott-Aldrich syndrome protein family. The gene product is a protein that forms a multiprotein complex that links receptor kinases and actin. Binding to actin occurs through a C-terminal verprolin homology domain in all family members. The multiprotein complex serves to tranduce signals that involve changes in cell shape, motility or function. The published map location (PMID:10381382) has been changed based on recent genomic sequence comparisons, which indicate that the expressed gene is located on chromosome 1, and a pseudogene may be located on chromosome X. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutants show impaired embryonic development and do not survive to term. In addition to reduced embryo size, observed defects include hemorrhaging, abnormal somite development, perturbed angiogenesis, and shrunken cerebral ventricles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Wasf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Wasf2 APN 4 133192128 missense unknown
IGL02028:Wasf2 APN 4 133195801 missense probably damaging 1.00
IGL03196:Wasf2 APN 4 133194421 missense unknown
IGL03225:Wasf2 APN 4 133176546 missense probably benign
Syndrome UTSW 4 133194909 critical splice donor site probably null
R1551:Wasf2 UTSW 4 133190172 missense unknown
R1646:Wasf2 UTSW 4 133176591 missense probably benign 0.25
R4776:Wasf2 UTSW 4 133185004 missense probably benign
R4929:Wasf2 UTSW 4 133195859 missense unknown
R6803:Wasf2 UTSW 4 133194909 critical splice donor site probably null
R6889:Wasf2 UTSW 4 133194730 missense unknown
R7208:Wasf2 UTSW 4 133195734 missense probably damaging 1.00
R7421:Wasf2 UTSW 4 133185101 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGTTTCAGATCAGAGCAACAG -3'
(R):5'- AAAAGGAGCCCTTCTCGGAG -3'

Sequencing Primer
(F):5'- AGACTCGCATAGCCCTGTGTG -3'
(R):5'- CTTCTCGGAGCAGGGAACAG -3'
Posted On2016-06-15