Incidental Mutation 'R5879:3110062M04Rik'
ID455709
Institutional Source Beutler Lab
Gene Symbol 3110062M04Rik
Ensembl Gene ENSMUSG00000046806
Gene NameRIKEN cDNA 3110062M04 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location34871771-34878060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34874658 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 87 (L87P)
Ref Sequence ENSEMBL: ENSMUSP00000113335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055097] [ENSMUST00000074949] [ENSMUST00000115006] [ENSMUST00000115007] [ENSMUST00000118559] [ENSMUST00000202010] [ENSMUST00000202999]
Predicted Effect probably benign
Transcript: ENSMUST00000055097
AA Change: L87P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000053349
Gene: ENSMUSG00000046806
AA Change: L87P

DomainStartEndE-ValueType
Pfam:MRI 55 157 2.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074949
SMART Domains Protein: ENSMUSP00000074482
Gene: ENSMUSG00000057137

DomainStartEndE-ValueType
Pfam:TM140 6 185 3e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115006
AA Change: L114P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110658
Gene: ENSMUSG00000046806
AA Change: L114P

DomainStartEndE-ValueType
Pfam:MRI 55 82 3.1e-13 PFAM
Pfam:MRI 97 184 1.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115007
AA Change: L87P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000110659
Gene: ENSMUSG00000046806
AA Change: L87P

DomainStartEndE-ValueType
Pfam:MRI 55 157 2.6e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118559
AA Change: L87P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113335
Gene: ENSMUSG00000046806
AA Change: L87P

DomainStartEndE-ValueType
Pfam:MRI 55 90 4.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140458
Predicted Effect probably benign
Transcript: ENSMUST00000202010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202764
Predicted Effect probably benign
Transcript: ENSMUST00000202999
SMART Domains Protein: ENSMUSP00000144113
Gene: ENSMUSG00000057137

DomainStartEndE-ValueType
Pfam:TM140 6 63 4.9e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in 3110062M04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02420:3110062M04Rik APN 6 34874469 missense probably damaging 1.00
R1853:3110062M04Rik UTSW 6 34875559 missense probably damaging 1.00
R6086:3110062M04Rik UTSW 6 34874620 missense probably damaging 0.99
R6484:3110062M04Rik UTSW 6 34874616 missense probably damaging 0.98
R7493:3110062M04Rik UTSW 6 34874658 missense probably damaging 0.99
R7716:3110062M04Rik UTSW 6 34875581 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCTGAAGCAGTGAACAATTCATAC -3'
(R):5'- AGCATGTCCCAACTTGGTC -3'

Sequencing Primer
(F):5'- CCTGACGTACTTCAACGCG -3'
(R):5'- CATGTCCCAACTTGGTCGTGTG -3'
Posted On2017-02-10