Incidental Mutation 'R5879:Ipo13'
ID455703
Institutional Source Beutler Lab
Gene Symbol Ipo13
Ensembl Gene ENSMUSG00000033365
Gene Nameimportin 13
SynonymsKap13
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location117894486-117914999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117903203 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 649 (T649I)
Ref Sequence ENSEMBL: ENSMUSP00000035989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036156
AA Change: T649I

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035989
Gene: ENSMUSG00000033365
AA Change: T649I

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
IBN_N 45 111 2.05e-7 SMART
Pfam:Xpo1 116 263 4.8e-29 PFAM
low complexity region 668 692 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153918
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the importin-beta family of nuclear transport proteins. The encoded protein mediates the import of specific cargo proteins from the cytoplasm to the nucleus and is dependent on the Ras-related nuclear protein-GTPase system. The encoded protein is also involved in nuclear export of the eukaryotic translation initiation factor 1A.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion die prior to genotyping age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Ipo13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ipo13 APN 4 117903405 missense probably benign 0.10
IGL00800:Ipo13 APN 4 117912308 missense probably benign 0.31
IGL00971:Ipo13 APN 4 117914367 missense possibly damaging 0.83
IGL01552:Ipo13 APN 4 117900964 missense probably benign 0.16
IGL01957:Ipo13 APN 4 117903881 missense probably damaging 0.99
IGL02262:Ipo13 APN 4 117903813 missense probably damaging 1.00
R0109:Ipo13 UTSW 4 117905016 missense possibly damaging 0.92
R0142:Ipo13 UTSW 4 117905569 missense probably damaging 1.00
R0771:Ipo13 UTSW 4 117894646 missense possibly damaging 0.78
R1248:Ipo13 UTSW 4 117901031 missense probably damaging 1.00
R1381:Ipo13 UTSW 4 117904395 missense probably damaging 1.00
R1497:Ipo13 UTSW 4 117904659 missense probably benign 0.04
R1614:Ipo13 UTSW 4 117904618 missense probably benign 0.00
R1711:Ipo13 UTSW 4 117904522 missense probably benign 0.38
R2037:Ipo13 UTSW 4 117904661 nonsense probably null
R2200:Ipo13 UTSW 4 117904903 critical splice donor site probably null
R3698:Ipo13 UTSW 4 117900693 missense probably damaging 1.00
R3949:Ipo13 UTSW 4 117901042 missense probably benign 0.10
R4687:Ipo13 UTSW 4 117901576 missense probably benign 0.06
R4894:Ipo13 UTSW 4 117903441 missense probably damaging 0.99
R4894:Ipo13 UTSW 4 117904490 missense possibly damaging 0.84
R4956:Ipo13 UTSW 4 117901571 missense probably benign 0.00
R5679:Ipo13 UTSW 4 117894832 missense probably damaging 1.00
R5921:Ipo13 UTSW 4 117912089 missense probably benign 0.14
R6250:Ipo13 UTSW 4 117912154 missense possibly damaging 0.93
R6875:Ipo13 UTSW 4 117904911 missense possibly damaging 0.90
R7178:Ipo13 UTSW 4 117903884 missense possibly damaging 0.83
R7412:Ipo13 UTSW 4 117894871 missense probably benign
R7687:Ipo13 UTSW 4 117911891 missense probably benign 0.01
R7774:Ipo13 UTSW 4 117914297 missense probably benign 0.11
Z1088:Ipo13 UTSW 4 117904680 missense probably benign 0.14
Z1176:Ipo13 UTSW 4 117904630 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTCAGGGAGCAATGCTAAC -3'
(R):5'- AGATCCTGAAGAACCTGCACTC -3'

Sequencing Primer
(F):5'- GTCAGGGAGCAATGCTAACATTACC -3'
(R):5'- TGAGTGAGCTCGGGGAC -3'
Posted On2017-02-10