Incidental Mutation 'R5879:Mthfd1'
ID455729
Institutional Source Beutler Lab
Gene Symbol Mthfd1
Ensembl Gene ENSMUSG00000021048
Gene Namemethylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
SynonymsMthfd, DCS, E430024A07Rik
Accession Numbers

Genbank: NM_138745; MGI: 1342005

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location76255298-76319803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76294218 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 464 (I464V)
Ref Sequence ENSEMBL: ENSMUSP00000021443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021443] [ENSMUST00000220046]
Predicted Effect probably benign
Transcript: ENSMUST00000021443
AA Change: I464V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000021443
Gene: ENSMUSG00000021048
AA Change: I464V

DomainStartEndE-ValueType
Pfam:THF_DHG_CYH 6 125 1.7e-36 PFAM
Pfam:THF_DHG_CYH_C 128 295 1.1e-67 PFAM
Pfam:FTHFS 317 935 4.1e-259 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218513
Predicted Effect probably benign
Transcript: ENSMUST00000220046
AA Change: I284V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a trifunctional cytoplasmic enzyme. The encoded protein functions as a methylenetetrahydrofolate dehydrogenase, a methenyltetrahydrofolate cyclohydrolase, and a formyltetrahydrofolate synthase. The encoded enzyme functions in de novo synthesis of purines and thymidylate and in regeneration of methionine from homocysteine. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality. Mice heterozygous for a gene trap allele exhibit altered amino acid levels and nucleotide metabolism related to dietary folate and choline concentrations. [provided by MGI curators]
Allele List at MGI

All alleles(57) : Targeted, other(2) Gene trapped(54) Radiation induced(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Mthfd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Mthfd1 APN 12 76300439 missense possibly damaging 0.79
IGL01996:Mthfd1 APN 12 76303905 missense probably damaging 1.00
IGL02399:Mthfd1 APN 12 76317632 missense probably damaging 1.00
IGL02529:Mthfd1 APN 12 76303709 missense probably benign 0.02
3-1:Mthfd1 UTSW 12 76314400 critical splice acceptor site probably null
R0062:Mthfd1 UTSW 12 76297589 splice site probably benign
R0062:Mthfd1 UTSW 12 76297589 splice site probably benign
R0732:Mthfd1 UTSW 12 76294174 missense probably damaging 1.00
R1572:Mthfd1 UTSW 12 76270419 nonsense probably null
R1918:Mthfd1 UTSW 12 76314976 missense probably damaging 1.00
R2008:Mthfd1 UTSW 12 76297519 missense probably damaging 1.00
R2280:Mthfd1 UTSW 12 76280492 missense probably benign 0.37
R2857:Mthfd1 UTSW 12 76288925 missense probably damaging 0.99
R2859:Mthfd1 UTSW 12 76288925 missense probably damaging 0.99
R2997:Mthfd1 UTSW 12 76315036 missense probably benign 0.01
R3034:Mthfd1 UTSW 12 76289470 missense probably benign 0.04
R3153:Mthfd1 UTSW 12 76311963 missense probably benign
R3412:Mthfd1 UTSW 12 76303749 splice site probably null
R4135:Mthfd1 UTSW 12 76282874 splice site probably null
R4245:Mthfd1 UTSW 12 76301273 missense probably damaging 0.99
R4498:Mthfd1 UTSW 12 76314990 missense probably damaging 1.00
R4573:Mthfd1 UTSW 12 76294138 critical splice acceptor site probably null
R5022:Mthfd1 UTSW 12 76294374 missense probably damaging 1.00
R5022:Mthfd1 UTSW 12 76301328 missense probably damaging 1.00
R5037:Mthfd1 UTSW 12 76294140 missense probably damaging 1.00
R5455:Mthfd1 UTSW 12 76301288 missense probably benign 0.20
R5902:Mthfd1 UTSW 12 76291052 missense probably benign 0.01
R6119:Mthfd1 UTSW 12 76303673 missense probably damaging 1.00
R6199:Mthfd1 UTSW 12 76288911 missense probably damaging 1.00
R6199:Mthfd1 UTSW 12 76303680 missense probably damaging 1.00
R6931:Mthfd1 UTSW 12 76303698 missense probably benign
R7405:Mthfd1 UTSW 12 76311874 missense probably damaging 0.98
R7658:Mthfd1 UTSW 12 76270435 missense probably damaging 1.00
R8053:Mthfd1 UTSW 12 76280508 missense probably damaging 1.00
X0012:Mthfd1 UTSW 12 76314408 missense possibly damaging 0.75
Z1176:Mthfd1 UTSW 12 76303967 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGCATATAGAAGCCCACTCG -3'
(R):5'- TCCGTTTACTGAAGGTACCAGAC -3'

Sequencing Primer
(F):5'- TGTCCAAGAGCAGTACTTCAG -3'
(R):5'- TTACTGAAGGTACCAGACGATTAAAG -3'
Posted On2017-02-10