Mutagenetix > Incidental Mutation

Incidental Mutation 'R4430:Stk10'

328573

Institutional Source

Beutler Lab

Gene Symbol

Stk10

Ensembl Gene

ENSMUSG00000020272

Gene Name

serine/threonine kinase 10

Synonyms

Gek1, Lok

MMRRC Submission

041700-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R4430 (G1)

Quality Score

211

Status

Not validated

Chromosome

Chromosomal Location

32533305-32624587 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32533552 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 50 (V50A)

Ref Sequence

ENSEMBL: ENSMUSP00000099885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102821] [ENSMUST00000109377]

AlphaFold

O55098

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102821
AA Change: V50A

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099885
Gene: ENSMUSG00000020272
AA Change: V50A

Domain	Start	End	E-Value	Type
S_TKc	36	294	8.66e-92	SMART
low complexity region	316	334	N/A	INTRINSIC
low complexity region	544	577	N/A	INTRINSIC
Pfam:PKK	586	724	1.9e-41	PFAM
Pfam:PKK	754	894	2.2e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109377

SMART Domains

Protein: ENSMUSP00000105002
Gene: ENSMUSG00000044056

Domain	Start	End	E-Value	Type
Blast:EFh	1	26	3e-7	BLAST
SCOP:d2sas__	2	88	2e-4	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the Ste20 family of serine/threonine protein kinases, and is similar to several known polo-like kinase kinases. Mice deficient for this gene product are viable, but exhibit altered integrin-mediated lymphocyte adhesion characteristics. The orthologous gene product in humans can associate with and phosphorylate polo-like kinase 1, and overexpression of a kinase-dead version of the protein interferes with normal cell cycle progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in enhanced cell adhesion in mitogen-stimulated T cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Aak1	A	G	6: 86,986,366	N926S	unknown	Het
Ahi1	T	A	10: 20,972,078	C462S	probably damaging	Het
Ahnak	A	G	19: 9,003,040	I563V	probably benign	Het
Ankrd55	G	A	13: 112,323,183		probably null	Het
Bag3	A	G	7: 128,523,923	D22G	probably damaging	Het
Cldn8	A	C	16: 88,562,731	M102R	probably damaging	Het
Col15a1	T	C	4: 47,245,705	F152S	probably damaging	Het
Cxcr2	T	C	1: 74,158,845	I166T	probably benign	Het
Dnah11	T	C	12: 117,983,011	I3113V	probably benign	Het
Gli2	T	C	1: 118,837,244	H1059R	probably benign	Het
Gm14412	C	A	2: 177,315,832	S90I	probably benign	Het
L1td1	A	G	4: 98,737,151	R528G	probably benign	Het
Mcm3	A	T	1: 20,811,993	L449*	probably null	Het
Mif4gd	T	C	11: 115,608,502	T185A	probably benign	Het
Mphosph9	T	C	5: 124,265,446	S840G	possibly damaging	Het
Nim1k	C	A	13: 119,712,542	R272L	possibly damaging	Het
Olfr1079	A	G	2: 86,538,387	I176T	probably damaging	Het
Olfr1457	C	T	19: 13,095,088	V187I	probably benign	Het
Olfr806	T	A	10: 129,738,261	I219F	probably damaging	Het
Pax3	A	G	1: 78,195,324	V83A	probably damaging	Het
Pde3b	C	T	7: 114,534,670	P974S	probably damaging	Het
Pdzd3	C	T	9: 44,249,744	S175N	probably benign	Het
Pglyrp3	T	A	3: 92,031,491	D324E	probably damaging	Het
Pus7	A	G	5: 23,746,489	Y521H	probably benign	Het
Ryr2	A	G	13: 11,735,527	S1953P	probably damaging	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
Sox5	A	G	6: 144,041,274	I188T	possibly damaging	Het
Spata4	T	C	8: 54,601,843	I86T	probably benign	Het
Ssc5d	T	C	7: 4,943,664	S1006P	probably benign	Het
Sytl4	A	G,T	X: 133,949,223	S338R	probably damaging	Homo
Sytl5	A	T	X: 9,960,023	N412Y	probably damaging	Het
Tert	T	A	13: 73,627,475	F115Y	probably damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tmem201	A	C	4: 149,731,139	V118G	probably benign	Het
Tmem67	T	A	4: 12,051,473	N785I	possibly damaging	Het
Trhde	A	T	10: 114,503,123	L594Q	probably damaging	Het
Ugt2b37	T	C	5: 87,254,092	M227V	probably benign	Het
Vmn2r22	T	C	6: 123,637,858	T258A	possibly damaging	Het
Vmn2r73	A	T	7: 85,870,241	M503K	probably benign	Het
Zfp54	T	G	17: 21,434,960	V572G	probably damaging	Het

Other mutations in Stk10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Stk10	APN	11	32577740	missense	probably benign	0.33
IGL01285:Stk10	APN	11	32610653	missense	possibly damaging	0.91
IGL01983:Stk10	APN	11	32589460	missense	probably benign	0.05
IGL03177:Stk10	APN	11	32614592	missense	probably damaging	1.00
IGL03183:Stk10	APN	11	32604143	missense	possibly damaging	0.50
coquet	UTSW	11	32577764	missense
legacy	UTSW	11	32604166	nonsense	probably null
mignon	UTSW	11	32587363	missense	probably damaging	1.00
R0481_stk10_383	UTSW	11	32614708	missense	probably damaging	1.00
FR4976:Stk10	UTSW	11	32614520	critical splice acceptor site	probably benign
R0003:Stk10	UTSW	11	32589460	missense	probably benign	0.05
R0008:Stk10	UTSW	11	32587305	splice site	probably benign
R0056:Stk10	UTSW	11	32617851	missense	possibly damaging	0.95
R0076:Stk10	UTSW	11	32603722	missense	probably benign
R0227:Stk10	UTSW	11	32617859	missense	probably damaging	1.00
R0440:Stk10	UTSW	11	32604190	missense	probably damaging	1.00
R0454:Stk10	UTSW	11	32596724	missense	probably damaging	0.99
R0481:Stk10	UTSW	11	32614708	missense	probably damaging	1.00
R0504:Stk10	UTSW	11	32617882	missense	probably benign	0.04
R0790:Stk10	UTSW	11	32598653	missense	probably benign	0.00
R1439:Stk10	UTSW	11	32617919	missense	probably damaging	0.98
R1539:Stk10	UTSW	11	32533440	missense	possibly damaging	0.85
R1770:Stk10	UTSW	11	32622464	missense	possibly damaging	0.94
R4304:Stk10	UTSW	11	32610634	missense	probably damaging	0.97
R4702:Stk10	UTSW	11	32555172	missense	probably benign	0.28
R4797:Stk10	UTSW	11	32598471	missense	probably benign	0.01
R5447:Stk10	UTSW	11	32604166	nonsense	probably null
R5801:Stk10	UTSW	11	32596748	missense	probably benign	0.01
R5802:Stk10	UTSW	11	32596748	missense	probably benign	0.01
R6129:Stk10	UTSW	11	32615871	missense	probably damaging	1.00
R6154:Stk10	UTSW	11	32603654	splice site	probably null
R6175:Stk10	UTSW	11	32603761	missense	possibly damaging	0.46
R6185:Stk10	UTSW	11	32577749	missense	probably benign	0.13
R6520:Stk10	UTSW	11	32588839	missense	probably damaging	1.00
R6824:Stk10	UTSW	11	32587363	missense	probably damaging	1.00
R7259:Stk10	UTSW	11	32598497	missense	probably benign	0.00
R7649:Stk10	UTSW	11	32577764	missense
R8331:Stk10	UTSW	11	32588928	missense
R8847:Stk10	UTSW	11	32589427	missense
R9252:Stk10	UTSW	11	32588915	missense
R9367:Stk10	UTSW	11	32588878	missense
X0027:Stk10	UTSW	11	32587361	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GACTACAGTCTCCAGAGTGC -3'
(R):5'- AGATGTGTCCCTATCACCGTGATC -3'

Sequencing Primer
(F):5'- AGCCAATTGAGGGGTCTCG -3'
(R):5'- CTATCACCGTGATCCTGGGGATG -3'

Posted On

2015-07-21