Incidental Mutation 'R4430:Stk10'
ID 328573
Institutional Source Beutler Lab
Gene Symbol Stk10
Ensembl Gene ENSMUSG00000020272
Gene Name serine/threonine kinase 10
Synonyms Gek1, Lok
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock # R4430 (G1)
Quality Score 211
Status Not validated
Chromosome 11
Chromosomal Location 32533305-32624587 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32533552 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 50 (V50A)
Ref Sequence ENSEMBL: ENSMUSP00000099885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102821] [ENSMUST00000109377]
AlphaFold O55098
Predicted Effect possibly damaging
Transcript: ENSMUST00000102821
AA Change: V50A

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099885
Gene: ENSMUSG00000020272
AA Change: V50A

DomainStartEndE-ValueType
S_TKc 36 294 8.66e-92 SMART
low complexity region 316 334 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
Pfam:PKK 586 724 1.9e-41 PFAM
Pfam:PKK 754 894 2.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109377
SMART Domains Protein: ENSMUSP00000105002
Gene: ENSMUSG00000044056

DomainStartEndE-ValueType
Blast:EFh 1 26 3e-7 BLAST
SCOP:d2sas__ 2 88 2e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Ste20 family of serine/threonine protein kinases, and is similar to several known polo-like kinase kinases. Mice deficient for this gene product are viable, but exhibit altered integrin-mediated lymphocyte adhesion characteristics. The orthologous gene product in humans can associate with and phosphorylate polo-like kinase 1, and overexpression of a kinase-dead version of the protein interferes with normal cell cycle progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in enhanced cell adhesion in mitogen-stimulated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Stk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Stk10 APN 11 32577740 missense probably benign 0.33
IGL01285:Stk10 APN 11 32610653 missense possibly damaging 0.91
IGL01983:Stk10 APN 11 32589460 missense probably benign 0.05
IGL03177:Stk10 APN 11 32614592 missense probably damaging 1.00
IGL03183:Stk10 APN 11 32604143 missense possibly damaging 0.50
coquet UTSW 11 32577764 missense
legacy UTSW 11 32604166 nonsense probably null
mignon UTSW 11 32587363 missense probably damaging 1.00
R0481_stk10_383 UTSW 11 32614708 missense probably damaging 1.00
FR4976:Stk10 UTSW 11 32614520 critical splice acceptor site probably benign
R0003:Stk10 UTSW 11 32589460 missense probably benign 0.05
R0008:Stk10 UTSW 11 32587305 splice site probably benign
R0056:Stk10 UTSW 11 32617851 missense possibly damaging 0.95
R0076:Stk10 UTSW 11 32603722 missense probably benign
R0227:Stk10 UTSW 11 32617859 missense probably damaging 1.00
R0440:Stk10 UTSW 11 32604190 missense probably damaging 1.00
R0454:Stk10 UTSW 11 32596724 missense probably damaging 0.99
R0481:Stk10 UTSW 11 32614708 missense probably damaging 1.00
R0504:Stk10 UTSW 11 32617882 missense probably benign 0.04
R0790:Stk10 UTSW 11 32598653 missense probably benign 0.00
R1439:Stk10 UTSW 11 32617919 missense probably damaging 0.98
R1539:Stk10 UTSW 11 32533440 missense possibly damaging 0.85
R1770:Stk10 UTSW 11 32622464 missense possibly damaging 0.94
R4304:Stk10 UTSW 11 32610634 missense probably damaging 0.97
R4702:Stk10 UTSW 11 32555172 missense probably benign 0.28
R4797:Stk10 UTSW 11 32598471 missense probably benign 0.01
R5447:Stk10 UTSW 11 32604166 nonsense probably null
R5801:Stk10 UTSW 11 32596748 missense probably benign 0.01
R5802:Stk10 UTSW 11 32596748 missense probably benign 0.01
R6129:Stk10 UTSW 11 32615871 missense probably damaging 1.00
R6154:Stk10 UTSW 11 32603654 splice site probably null
R6175:Stk10 UTSW 11 32603761 missense possibly damaging 0.46
R6185:Stk10 UTSW 11 32577749 missense probably benign 0.13
R6520:Stk10 UTSW 11 32588839 missense probably damaging 1.00
R6824:Stk10 UTSW 11 32587363 missense probably damaging 1.00
R7259:Stk10 UTSW 11 32598497 missense probably benign 0.00
R7649:Stk10 UTSW 11 32577764 missense
R8331:Stk10 UTSW 11 32588928 missense
R8847:Stk10 UTSW 11 32589427 missense
R9252:Stk10 UTSW 11 32588915 missense
R9367:Stk10 UTSW 11 32588878 missense
X0027:Stk10 UTSW 11 32587361 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACTACAGTCTCCAGAGTGC -3'
(R):5'- AGATGTGTCCCTATCACCGTGATC -3'

Sequencing Primer
(F):5'- AGCCAATTGAGGGGTCTCG -3'
(R):5'- CTATCACCGTGATCCTGGGGATG -3'
Posted On 2015-07-21