Incidental Mutation 'R5953:Il1rl1'
ID470980
Institutional Source Beutler Lab
Gene Symbol Il1rl1
Ensembl Gene ENSMUSG00000026069
Gene Nameinterleukin 1 receptor-like 1
SynonymsT1 gene, St2-rs1, ST2, T1, T1/ST2, Ly84, Fit-1, DER4, St2, ST2L
MMRRC Submission 043245-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5953 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location40429570-40465415 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40442673 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 180 (D180E)
Ref Sequence ENSEMBL: ENSMUSP00000134351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053043] [ENSMUST00000097772] [ENSMUST00000173514] [ENSMUST00000173881] [ENSMUST00000174335]
Predicted Effect probably benign
Transcript: ENSMUST00000053043
AA Change: D180E

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000054914
Gene: ENSMUSG00000026069
AA Change: D180E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGc2 33 100 7.35e-11 SMART
IGc2 130 194 8.85e-5 SMART
IG_like 225 326 2.66e1 SMART
transmembrane domain 333 355 N/A INTRINSIC
TIR 381 543 4.23e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097772
AA Change: D180E

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095379
Gene: ENSMUSG00000026069
AA Change: D180E

DomainStartEndE-ValueType
IGc2 33 100 7.35e-11 SMART
IGc2 130 194 8.85e-5 SMART
IG_like 225 326 2.66e1 SMART
transmembrane domain 333 355 N/A INTRINSIC
TIR 381 543 4.23e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173514
AA Change: D180E

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133784
Gene: ENSMUSG00000026069
AA Change: D180E

DomainStartEndE-ValueType
IGc2 33 100 7.35e-11 SMART
IGc2 130 194 8.85e-5 SMART
IG_like 225 326 2.66e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173881
SMART Domains Protein: ENSMUSP00000134225
Gene: ENSMUSG00000026069

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:4KC3|B 27 65 4e-16 PDB
Blast:IGc2 33 65 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174335
AA Change: D180E

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134351
Gene: ENSMUSG00000026069
AA Change: D180E

DomainStartEndE-ValueType
IGc2 33 100 7.35e-11 SMART
IGc2 130 194 8.85e-5 SMART
IG_like 225 326 2.66e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 receptor family. Studies of the similar gene in mouse suggested that this receptor can be induced by proinflammatory stimuli, and may be involved in the function of helper T cells. This gene, interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2) and interleukin 1 receptor-like 2 (IL1RL2) form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an abnormal Th2 type inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Asns T C 6: 7,682,285 E220G probably benign Het
Cd209d A T 8: 3,877,979 probably null Het
Cenpp T C 13: 49,652,685 D2G probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Clec4a3 G T 6: 122,969,492 V232L probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Cym T A 3: 107,213,467 D274V probably damaging Het
Elac2 G A 11: 64,999,223 C627Y probably benign Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il2rb A T 15: 78,484,982 C256* probably null Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr1474 A T 19: 13,471,368 I133F possibly damaging Het
Olfr812 C G 10: 129,842,614 V143L probably benign Het
Pglyrp1 A T 7: 18,890,313 I174F probably damaging Het
Pi4ka A T 16: 17,281,951 I1936N probably damaging Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Pygl T C 12: 70,219,627 D38G probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
S100a9 T A 3: 90,692,927 K54M probably damaging Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Slc17a5 T C 9: 78,557,498 N331S probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Trem1 A T 17: 48,237,192 M82L probably benign Het
Other mutations in Il1rl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Il1rl1 APN 1 40446216 missense possibly damaging 0.75
IGL01413:Il1rl1 APN 1 40446169 missense possibly damaging 0.85
IGL01939:Il1rl1 APN 1 40462008 missense possibly damaging 0.80
IGL02121:Il1rl1 APN 1 40442303 splice site probably benign
IGL02160:Il1rl1 APN 1 40461837 missense probably benign 0.00
IGL02695:Il1rl1 APN 1 40446558 missense possibly damaging 0.47
R0007:Il1rl1 UTSW 1 40446171 missense possibly damaging 0.95
R0105:Il1rl1 UTSW 1 40442574 splice site probably benign
R0200:Il1rl1 UTSW 1 40441303 missense possibly damaging 0.95
R0363:Il1rl1 UTSW 1 40442574 splice site probably benign
R0508:Il1rl1 UTSW 1 40451717 missense possibly damaging 0.87
R0637:Il1rl1 UTSW 1 40442574 splice site probably benign
R0676:Il1rl1 UTSW 1 40442574 splice site probably benign
R1371:Il1rl1 UTSW 1 40442713 missense probably damaging 0.96
R2074:Il1rl1 UTSW 1 40462044 missense probably damaging 0.99
R2309:Il1rl1 UTSW 1 40442657 missense possibly damaging 0.46
R2426:Il1rl1 UTSW 1 40446619 missense probably damaging 1.00
R3983:Il1rl1 UTSW 1 40446663 missense possibly damaging 0.73
R4601:Il1rl1 UTSW 1 40441300 missense possibly damaging 0.88
R4707:Il1rl1 UTSW 1 40450188 missense probably damaging 0.96
R4720:Il1rl1 UTSW 1 40446678 missense probably benign 0.24
R4784:Il1rl1 UTSW 1 40450188 missense probably damaging 0.96
R5137:Il1rl1 UTSW 1 40450125 missense probably benign
R5765:Il1rl1 UTSW 1 40461943 missense probably benign 0.06
R6339:Il1rl1 UTSW 1 40461856 missense possibly damaging 0.88
R7176:Il1rl1 UTSW 1 40446606 missense probably damaging 1.00
R7677:Il1rl1 UTSW 1 40446704 makesense probably null
R8129:Il1rl1 UTSW 1 40451827 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTAAACGTTTGAAATCTGGGG -3'
(R):5'- ACCTATGCTTCATGGCAACTTC -3'

Sequencing Primer
(F):5'- TCTGGGGAGAAAATGATAACATCTGC -3'
(R):5'- GGCAACTTCCTTTCATGTTAGAG -3'
Posted On2017-03-31