Mutagenetix > Incidental Mutation

Incidental Mutation 'R5950:Dis3l2'

472362

Institutional Source

Beutler Lab

Gene Symbol

Dis3l2

Ensembl Gene

ENSMUSG00000053333

Gene Name

DIS3 like 3'-5' exoribonuclease 2

Synonyms

4930429A22Rik, 8030493P09Rik

MMRRC Submission

044140-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.422) question?

Stock #

R5950 (G1)

Quality Score

151

Status

Validated

Chromosome

Chromosomal Location

86703808-87050095 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87021108 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 589 (D589G)

Ref Sequence

ENSEMBL: ENSMUSP00000132673 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]

AlphaFold

Q8CI75

Predicted Effect

probably benign
Transcript: ENSMUST00000065694
AA Change: D575G

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: D575G

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	369	719	8.9e-140	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168237
AA Change: D589G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: D589G

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	383	733	8.9e-140	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185304

Predicted Effect

probably benign
Transcript: ENSMUST00000190618

SMART Domains

Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
PDB:2VNU\|D	50	123	4e-10	PDB

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

93% (75/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930539E08Rik	T	A	17: 28,905,755	Q256L	possibly damaging	Het
Abca15	G	A	7: 120,382,656	G1065R	probably damaging	Het
Acox2	A	T	14: 8,255,793	Y113N	probably benign	Het
Arid4b	T	A	13: 14,191,264		probably benign	Het
Atf6	C	T	1: 170,834,879	G271R	probably damaging	Het
Cct8l1	C	A	5: 25,517,743	F485L	probably benign	Het
Cdk5r2	A	G	1: 74,855,402	E102G	probably damaging	Het
Celsr1	A	T	15: 86,032,500	V424E	probably damaging	Het
Ces1h	T	C	8: 93,362,959	T271A	probably benign	Het
Cfap44	T	C	16: 44,479,847	I1738T	probably damaging	Het
Cntnap3	G	A	13: 64,787,769	L427F	probably damaging	Het
Crybg3	T	C	16: 59,493,571		probably benign	Het
Dlg1	A	G	16: 31,665,583	R10G	probably damaging	Het
Dnajc1	A	C	2: 18,306,941		probably benign	Het
Dpy19l2	T	A	9: 24,581,134	T723S	probably benign	Het
Dsg3	A	T	18: 20,538,529	N764Y	probably damaging	Het
Dst	G	T	1: 34,262,060	R3654L	probably damaging	Het
Evl	C	T	12: 108,675,553	T198I	probably benign	Het
Hectd2	A	G	19: 36,597,239		probably benign	Het
Hsp90b1	A	G	10: 86,701,745	V232A	possibly damaging	Het
Igsf5	T	C	16: 96,372,872	V34A	probably benign	Het
Ikzf2	A	T	1: 69,683,244	N41K	probably damaging	Het
Kif6	G	T	17: 49,715,088	A339S	probably damaging	Het
Klhl1	T	A	14: 96,240,354	D426V	probably damaging	Het
Knop1	A	C	7: 118,853,334	V54G	probably damaging	Het
Lama4	T	A	10: 39,030,448	V270D	probably benign	Het
Lnx2	A	G	5: 147,024,350		probably null	Het
Lrp5	A	T	19: 3,602,333	V1179E	probably benign	Het
Lrpprc	T	G	17: 84,740,170	D878A	possibly damaging	Het
Lrrc14	A	T	15: 76,715,310		probably benign	Het
Ltbp1	A	T	17: 75,273,870	D660V	probably damaging	Het
Macf1	C	G	4: 123,439,436		probably null	Het
Map3k21	C	A	8: 125,941,760	T695K	possibly damaging	Het
Mcm3ap	T	A	10: 76,488,419	D895E	possibly damaging	Het
Mfsd7a	A	T	5: 108,445,485	H162Q	probably damaging	Het
Mink1	T	A	11: 70,609,586	D779E	possibly damaging	Het
Mkrn3	T	C	7: 62,419,719	E108G	probably damaging	Het
Nars	A	G	18: 64,510,485	V141A	possibly damaging	Het
Olfr954	T	C	9: 39,462,337	V299A	probably benign	Het
Pard3b	T	A	1: 62,216,531	Y572N	probably benign	Het
Pcnx3	A	C	19: 5,667,158	M1599R	possibly damaging	Het
Pitx2	A	G	3: 129,218,520	S180G	probably damaging	Het
Pkd2l1	A	C	19: 44,152,090	V608G	probably benign	Het
Pkhd1l1	A	G	15: 44,532,965	D1961G	probably benign	Het
Pxylp1	T	C	9: 96,839,126	T109A	probably damaging	Het
Rai1	T	A	11: 60,187,593	C828S	probably damaging	Het
Ralgapa1	T	A	12: 55,738,265	T737S	possibly damaging	Het
Scn11a	A	G	9: 119,811,124	V235A	probably damaging	Het
Sfxn1	A	T	13: 54,091,287	T134S	probably benign	Het
Skint1	A	G	4: 112,019,335	Y151C	probably benign	Het
Slc11a1	G	T	1: 74,377,176	W54L	probably benign	Het
Soga3	T	C	10: 29,143,648		probably benign	Het
Synpo2l	T	A	14: 20,665,935	Q191L	probably benign	Het
Tank	A	G	2: 61,653,569		probably benign	Het
Tctex1d1	T	G	4: 103,004,250	L147R	probably damaging	Het
Terb1	A	T	8: 104,488,485		probably null	Het
Trdc	T	C	14: 54,144,311		probably benign	Het
Tsen34	A	G	7: 3,694,788	I63V	probably null	Het
Ust	T	C	10: 8,248,101	H257R	probably benign	Het
Vmn2r6	T	C	3: 64,565,231	Q23R	probably benign	Het
Wdr93	A	T	7: 79,773,431	H481L	probably damaging	Het
Xirp2	A	G	2: 67,511,320	T1302A	possibly damaging	Het
Zc3h6	C	A	2: 128,997,790	Y174*	probably null	Het
Zcchc7	T	G	4: 44,931,244	D144E	possibly damaging	Het
Zfp472	T	A	17: 32,977,507	H185Q	possibly damaging	Het
Zfp523	C	A	17: 28,202,558	P66H	probably benign	Het
Zfp712	A	T	13: 67,044,817	L57Q	probably damaging	Het
Zik1	G	A	7: 10,490,571	Q200*	probably null	Het

Other mutations in Dis3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Dis3l2	APN	1	86857203	missense	probably benign	0.00
IGL01607:Dis3l2	APN	1	86745487	missense	probably benign	0.04
IGL02233:Dis3l2	APN	1	86990231	missense	probably damaging	1.00
IGL02698:Dis3l2	APN	1	87048829	splice site	probably benign
R0514:Dis3l2	UTSW	1	87047092	missense	probably damaging	1.00
R0893:Dis3l2	UTSW	1	87044206	splice site	probably null
R1086:Dis3l2	UTSW	1	86990149	missense	probably benign	0.36
R1140:Dis3l2	UTSW	1	86821438	missense	probably benign	0.00
R1509:Dis3l2	UTSW	1	87021086	missense	possibly damaging	0.91
R2029:Dis3l2	UTSW	1	86854467	splice site	probably benign
R2511:Dis3l2	UTSW	1	86990258	missense	probably benign	0.05
R3772:Dis3l2	UTSW	1	86854408	missense	probably benign
R4163:Dis3l2	UTSW	1	86821237	missense	probably benign	0.00
R4547:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4548:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4650:Dis3l2	UTSW	1	86990321	missense	possibly damaging	0.83
R4810:Dis3l2	UTSW	1	87047574	missense	probably damaging	0.99
R4936:Dis3l2	UTSW	1	87044168	missense	probably benign	0.00
R5010:Dis3l2	UTSW	1	86760321	missense	probably benign	0.21
R5040:Dis3l2	UTSW	1	86857337	missense	probably damaging	0.98
R5272:Dis3l2	UTSW	1	86973404	missense	possibly damaging	0.72
R5500:Dis3l2	UTSW	1	87021119	critical splice donor site	probably null
R5556:Dis3l2	UTSW	1	86973404	missense	possibly damaging	0.72
R5772:Dis3l2	UTSW	1	86878432	missense	probably damaging	1.00
R5808:Dis3l2	UTSW	1	87049638	missense	possibly damaging	0.94
R6328:Dis3l2	UTSW	1	86854431	missense	probably benign	0.05
R6553:Dis3l2	UTSW	1	86745494	missense	probably damaging	1.00
R6585:Dis3l2	UTSW	1	86745494	missense	probably damaging	1.00
R6905:Dis3l2	UTSW	1	87044839	missense	probably benign	0.00
R6921:Dis3l2	UTSW	1	86857341	missense	probably benign
R7162:Dis3l2	UTSW	1	87044030	missense	possibly damaging	0.94
R7270:Dis3l2	UTSW	1	86990303	missense	possibly damaging	0.49
R7438:Dis3l2	UTSW	1	86745500	critical splice donor site	probably null
R8422:Dis3l2	UTSW	1	86854377	missense	probably benign
R8696:Dis3l2	UTSW	1	86791440	nonsense	probably null
R9235:Dis3l2	UTSW	1	86821339	missense	possibly damaging	0.95
R9291:Dis3l2	UTSW	1	86973493	missense	possibly damaging	0.82
R9629:Dis3l2	UTSW	1	87047062	missense	probably benign	0.00
X0027:Dis3l2	UTSW	1	86760351	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TGGCGTTTCCACAGCACATC -3'
(R):5'- CACCTTCCACAGTGTTTGGC -3'

Sequencing Primer
(F):5'- ATCCACTGCAGGGAGCTGAC -3'
(R):5'- GGGGTTAAAACTCAGGTCCTTACAC -3'

Posted On

2017-03-31