Incidental Mutation 'R4547:Dis3l2'
ID333800
Institutional Source Beutler Lab
Gene Symbol Dis3l2
Ensembl Gene ENSMUSG00000053333
Gene NameDIS3 like 3'-5' exoribonuclease 2
Synonyms4930429A22Rik, 8030493P09Rik
MMRRC Submission 041781-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R4547 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location86703808-87050095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87049671 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 861 (T861S)
Ref Sequence ENSEMBL: ENSMUSP00000132673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]
Predicted Effect probably benign
Transcript: ENSMUST00000065694
AA Change: T847S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: T847S

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 369 719 8.9e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168237
AA Change: T861S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: T861S

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 383 733 8.9e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185304
Predicted Effect probably benign
Transcript: ENSMUST00000190618
SMART Domains Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
PDB:2VNU|D 50 123 4e-10 PDB
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 G T 14: 54,645,667 A909E probably benign Het
Ankrd13a A G 5: 114,775,296 E23G probably benign Het
Ano4 T C 10: 88,981,170 R148G probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Aspm T C 1: 139,478,187 V1604A possibly damaging Het
Cdh1 C A 8: 106,663,903 T625K probably damaging Het
Cfap65 G A 1: 74,907,612 T1313I probably damaging Het
Cfhr3 T G 1: 139,584,913 noncoding transcript Het
Csmd1 T C 8: 16,391,797 D351G possibly damaging Het
Dnah6 A T 6: 73,192,405 D404E probably benign Het
Dpm1 A G 2: 168,223,153 L88P probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fat4 T C 3: 38,951,283 F1944L probably damaging Het
Frmd4a C A 2: 4,473,145 L46I probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hace1 T A 10: 45,672,555 probably null Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klb T A 5: 65,379,928 V867E probably benign Het
Lnpk C G 2: 74,522,286 E351Q probably benign Het
Mettl25 T C 10: 105,826,017 D364G probably damaging Het
Mrc2 G A 11: 105,336,641 V567I probably benign Het
Mrm2 T C 5: 140,328,496 T195A probably benign Het
Naaa C T 5: 92,263,586 probably null Het
Ncdn A G 4: 126,746,674 F542S probably damaging Het
Nlrp4e A G 7: 23,336,866 N715D probably benign Het
Nupl2 T C 5: 24,177,970 probably benign Het
Olfr1122 G A 2: 87,388,160 V152I probably benign Het
Olfr720 A T 14: 14,175,854 I76N probably damaging Het
Psg25 A G 7: 18,524,704 L349P probably damaging Het
Rnf213 G T 11: 119,479,670 probably null Het
Scara5 A C 14: 65,670,574 K4N possibly damaging Het
Slc35f5 T C 1: 125,572,382 L211S probably benign Het
Slc44a4 T A 17: 34,927,755 F285I probably damaging Het
Slc8a3 A G 12: 81,314,851 V398A possibly damaging Het
Smc2 T C 4: 52,467,866 S737P probably benign Het
Speer2 T C 16: 69,858,849 K30E probably damaging Het
Synj1 T C 16: 90,988,282 I229V possibly damaging Het
Tac1 A G 6: 7,557,216 D74G probably damaging Het
Tbc1d17 A G 7: 44,841,347 V607A probably benign Het
Tmem132a A G 19: 10,860,200 V582A possibly damaging Het
Traf4 A G 11: 78,161,037 I207T possibly damaging Het
Trio T C 15: 27,818,982 R449G possibly damaging Het
Ubn1 G A 16: 5,072,092 R407H probably damaging Het
Vmn1r19 C T 6: 57,404,789 T109I possibly damaging Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vsig8 A T 1: 172,560,596 M44L probably benign Het
Zbed5 T A 5: 129,902,851 L547* probably null Het
Other mutations in Dis3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Dis3l2 APN 1 86857203 missense probably benign 0.00
IGL01607:Dis3l2 APN 1 86745487 missense probably benign 0.04
IGL02233:Dis3l2 APN 1 86990231 missense probably damaging 1.00
IGL02698:Dis3l2 APN 1 87048829 splice site probably benign
R0514:Dis3l2 UTSW 1 87047092 missense probably damaging 1.00
R0893:Dis3l2 UTSW 1 87044206 splice site probably null
R1086:Dis3l2 UTSW 1 86990149 missense probably benign 0.36
R1140:Dis3l2 UTSW 1 86821438 missense probably benign 0.00
R1509:Dis3l2 UTSW 1 87021086 missense possibly damaging 0.91
R2029:Dis3l2 UTSW 1 86854467 splice site probably benign
R2511:Dis3l2 UTSW 1 86990258 missense probably benign 0.05
R3772:Dis3l2 UTSW 1 86854408 missense probably benign
R4163:Dis3l2 UTSW 1 86821237 missense probably benign 0.00
R4548:Dis3l2 UTSW 1 87049671 missense probably benign 0.00
R4650:Dis3l2 UTSW 1 86990321 missense possibly damaging 0.83
R4810:Dis3l2 UTSW 1 87047574 missense probably damaging 0.99
R4936:Dis3l2 UTSW 1 87044168 missense probably benign 0.00
R5010:Dis3l2 UTSW 1 86760321 missense probably benign 0.21
R5040:Dis3l2 UTSW 1 86857337 missense probably damaging 0.98
R5272:Dis3l2 UTSW 1 86973404 missense possibly damaging 0.72
R5500:Dis3l2 UTSW 1 87021119 critical splice donor site probably null
R5556:Dis3l2 UTSW 1 86973404 missense possibly damaging 0.72
R5772:Dis3l2 UTSW 1 86878432 missense probably damaging 1.00
R5808:Dis3l2 UTSW 1 87049638 missense possibly damaging 0.94
R5950:Dis3l2 UTSW 1 87021108 missense probably damaging 0.96
R6328:Dis3l2 UTSW 1 86854431 missense probably benign 0.05
R6553:Dis3l2 UTSW 1 86745494 missense probably damaging 1.00
R6585:Dis3l2 UTSW 1 86745494 missense probably damaging 1.00
R6905:Dis3l2 UTSW 1 87044839 missense probably benign 0.00
R6921:Dis3l2 UTSW 1 86857341 missense probably benign
R7162:Dis3l2 UTSW 1 87044030 missense possibly damaging 0.94
R7270:Dis3l2 UTSW 1 86990303 missense possibly damaging 0.49
R7438:Dis3l2 UTSW 1 86745500 critical splice donor site probably null
X0027:Dis3l2 UTSW 1 86760351 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGAATCCCATTTACAGATAGGCG -3'
(R):5'- ATCCTCTCTGCTCAGGGAAG -3'

Sequencing Primer
(F):5'- TCCCATTTACAGATAGGCGATAGAG -3'
(R):5'- TCTCTGCTCAGGGAAGCACAG -3'
Posted On2015-08-18