Incidental Mutation 'R6052:Canx'
ID484175
Institutional Source Beutler Lab
Gene Symbol Canx
Ensembl Gene ENSMUSG00000020368
Gene Namecalnexin
Synonyms1110069N15Rik, CNX
MMRRC Submission 044220-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R6052 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location50293961-50325673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50297119 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 554 (D554G)
Ref Sequence ENSEMBL: ENSMUSP00000137440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020637] [ENSMUST00000059458] [ENSMUST00000179865]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020637
AA Change: D554G

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020637
Gene: ENSMUSG00000020368
AA Change: D554G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 72 441 1.7e-170 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059458
SMART Domains Protein: ENSMUSP00000059210
Gene: ENSMUSG00000050567

DomainStartEndE-ValueType
MamL-1 14 73 1.04e-32 SMART
low complexity region 77 102 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 373 383 N/A INTRINSIC
low complexity region 419 435 N/A INTRINSIC
low complexity region 588 600 N/A INTRINSIC
coiled coil region 627 671 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155801
Predicted Effect possibly damaging
Transcript: ENSMUST00000179865
AA Change: D554G

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137440
Gene: ENSMUSG00000020368
AA Change: D554G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 70 441 4.7e-166 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calnexin family of molecular chaperones. The encoded protein is a calcium-binding, endoplasmic reticulum (ER)-associated protein that interacts transiently with newly synthesized N-linked glycoproteins, facilitating protein folding and assembly. It may also play a central role in the quality control of protein folding by retaining incorrectly folded protein subunits within the ER for degradation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit motor defects, loss of large myelinated nerve fibers, small size, and very high mortality between birth and 4 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,318,191 F473L probably benign Het
Ankrd17 T C 5: 90,253,832 I1449V probably benign Het
Aox4 T A 1: 58,254,318 L943* probably null Het
Arap1 G A 7: 101,404,033 V1257M probably damaging Het
B3gnt9 T C 8: 105,254,598 S53G probably benign Het
Baiap3 A T 17: 25,248,470 probably benign Het
Cbfa2t2 T C 2: 154,510,581 V165A probably damaging Het
Ccdc17 C T 4: 116,599,948 probably null Het
Cdcp1 A G 9: 123,185,331 I126T probably benign Het
Cdk13 A T 13: 17,721,215 D1036E probably damaging Het
Cfap157 A G 2: 32,779,851 L240P probably damaging Het
Clec18a C A 8: 111,078,816 E218* probably null Het
Col3a1 T C 1: 45,345,013 probably benign Het
Dennd4a A G 9: 64,886,945 E682G probably damaging Het
Dnah14 T C 1: 181,666,487 V1736A possibly damaging Het
Dpep2 T A 8: 105,990,638 D162V possibly damaging Het
Drd3 C A 16: 43,821,283 P321T probably benign Het
Egfr A G 11: 16,911,554 H1111R probably benign Het
Entpd1 T C 19: 40,720,484 S58P probably damaging Het
Epha3 C A 16: 63,603,604 V541L possibly damaging Het
Eri3 T A 4: 117,564,628 D34E probably damaging Het
Eya1 T C 1: 14,283,150 D58G probably damaging Het
Fat3 T A 9: 15,922,679 S26C probably null Het
Fgl1 T C 8: 41,200,511 D115G probably damaging Het
Fitm2 T C 2: 163,470,116 Y59C probably damaging Het
Fras1 T A 5: 96,764,866 I3343N probably damaging Het
Gba2 C A 4: 43,568,330 C679F probably damaging Het
Glis2 G A 16: 4,613,739 probably benign Het
Gm13088 T A 4: 143,655,652 D158V probably damaging Het
Gm5150 T A 3: 15,990,753 I103F probably damaging Het
H2-Ke6 A G 17: 34,027,455 L118P probably damaging Het
Hhipl2 T C 1: 183,424,057 S313P possibly damaging Het
Hmgcs1 A G 13: 119,705,459 D474G probably benign Het
Homer3 C T 8: 70,291,426 Q267* probably null Het
Igkv8-28 C T 6: 70,143,689 G90D probably damaging Het
Kalrn T A 16: 34,360,885 I128F probably damaging Het
Krt4 A G 15: 101,922,759 probably null Het
Lamb2 T A 9: 108,487,612 C1188* probably null Het
Lsr A T 7: 30,958,617 M355K probably damaging Het
Map3k11 T G 19: 5,697,402 D555E probably benign Het
Myocd A G 11: 65,196,256 Y282H probably damaging Het
Nae1 T C 8: 104,534,544 I7M probably benign Het
Nprl3 G T 11: 32,255,453 H102N possibly damaging Het
Nup62 T A 7: 44,829,040 F160I possibly damaging Het
Olfr1490 C A 19: 13,654,507 P26Q possibly damaging Het
Olfr456 T A 6: 42,486,654 T180S possibly damaging Het
Olfr502 A G 7: 108,523,738 S71P probably benign Het
Olfr709-ps1 A T 7: 106,926,689 F257I probably benign Het
Olfr781 C A 10: 129,333,202 T107K possibly damaging Het
Osbpl10 T C 9: 115,067,315 probably null Het
Pcdh9 C T 14: 93,885,846 V963I probably benign Het
Phf12 A G 11: 78,018,218 R375G probably benign Het
Piezo1 G A 8: 122,506,269 T108M probably damaging Het
Plxnc1 T A 10: 94,943,773 Q269L probably benign Het
Pomgnt1 T A 4: 116,151,602 N11K possibly damaging Het
Prkd1 A T 12: 50,366,300 probably null Het
Prpf40a T C 2: 53,159,281 T190A probably benign Het
Prrc2b A C 2: 32,212,285 H790P possibly damaging Het
Rest T G 5: 77,281,180 V482G probably benign Het
Ros1 T A 10: 52,163,903 I322L probably benign Het
Rpl18 G A 7: 45,720,130 probably benign Het
Rsad2 G A 12: 26,450,578 H237Y probably benign Het
Sbf2 A G 7: 110,441,534 L362S probably damaging Het
Sgsm3 A G 15: 81,009,263 T409A probably benign Het
Slc16a14 T C 1: 84,912,709 T292A possibly damaging Het
Spg11 T G 2: 122,097,356 K649T probably damaging Het
Srprb T A 9: 103,190,216 I268F possibly damaging Het
Tap2 G A 17: 34,214,709 G566S probably damaging Het
Tecpr2 T C 12: 110,918,891 V168A possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Tmem181a T A 17: 6,280,615 L50H probably damaging Het
Tshz1 A G 18: 84,014,069 I738T probably damaging Het
Tspan12 T C 6: 21,772,638 E304G probably benign Het
Urb1 C T 16: 90,762,383 G1671S probably damaging Het
Vmn2r2 T C 3: 64,117,361 S600G possibly damaging Het
Wnt3 C A 11: 103,808,174 Y35* probably null Het
Xpo7 T C 14: 70,683,719 Y603C possibly damaging Het
Zfp457 G A 13: 67,293,951 H91Y probably damaging Het
Zfp664 T A 5: 124,886,186 C215S unknown Het
Zfp882 G A 8: 71,914,505 G392D probably benign Het
Other mutations in Canx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Canx APN 11 50300996 missense possibly damaging 0.61
IGL03089:Canx APN 11 50304482 missense possibly damaging 0.85
R1428:Canx UTSW 11 50308394 splice site probably benign
R1876:Canx UTSW 11 50304359 missense probably damaging 1.00
R2057:Canx UTSW 11 50304425 missense probably damaging 0.97
R2058:Canx UTSW 11 50304425 missense probably damaging 0.97
R2088:Canx UTSW 11 50310390 missense possibly damaging 0.89
R2126:Canx UTSW 11 50304358 missense probably damaging 1.00
R2217:Canx UTSW 11 50310867 missense probably benign 0.24
R2218:Canx UTSW 11 50310867 missense probably benign 0.24
R2386:Canx UTSW 11 50297106 missense probably benign
R3716:Canx UTSW 11 50304474 missense probably benign 0.14
R3957:Canx UTSW 11 50308383 missense probably damaging 1.00
R4019:Canx UTSW 11 50299245 missense probably damaging 1.00
R4402:Canx UTSW 11 50304438 missense probably benign 0.13
R4825:Canx UTSW 11 50308809 missense probably benign 0.42
R5252:Canx UTSW 11 50308794 missense probably damaging 1.00
R5385:Canx UTSW 11 50301812 missense probably damaging 1.00
R5797:Canx UTSW 11 50301017 missense probably benign 0.00
R5820:Canx UTSW 11 50308383 missense probably damaging 1.00
R7259:Canx UTSW 11 50301816 missense probably damaging 1.00
R7603:Canx UTSW 11 50311628 missense probably benign
R7715:Canx UTSW 11 50310804 missense probably benign 0.13
R7735:Canx UTSW 11 50301039 missense probably damaging 0.97
R8063:Canx UTSW 11 50308346 nonsense probably null
R8069:Canx UTSW 11 50311704 missense possibly damaging 0.93
R8494:Canx UTSW 11 50311782 critical splice acceptor site probably null
R8508:Canx UTSW 11 50311647 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGTTTAAAATGCAGTGGTATTCAAGA -3'
(R):5'- TACAAGAAGACGGATGCTCC -3'

Sequencing Primer
(F):5'- TTCAAGAAATACCTTTGAGGGGAC -3'
(R):5'- TCCCCAGCCAGATGTGAAG -3'
Posted On2017-07-14