Incidental Mutation 'R6037:Asgr1'
ID486644
Institutional Source Beutler Lab
Gene Symbol Asgr1
Ensembl Gene ENSMUSG00000020884
Gene Nameasialoglycoprotein receptor 1
SynonymsAsgr-1, Asgr, ASGPR1
MMRRC Submission 043258-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6037 (G1)
Quality Score140.008
Status Not validated
Chromosome11
Chromosomal Location70054085-70057894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70056421 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 96 (S96R)
Ref Sequence ENSEMBL: ENSMUSP00000121842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018699] [ENSMUST00000092959] [ENSMUST00000108585] [ENSMUST00000123369] [ENSMUST00000146411]
Predicted Effect probably benign
Transcript: ENSMUST00000018699
AA Change: S96R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000018699
Gene: ENSMUSG00000020884
AA Change: S96R

DomainStartEndE-ValueType
Pfam:Lectin_N 6 143 1.1e-67 PFAM
CLECT 153 277 2.23e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092959
AA Change: S96R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000090637
Gene: ENSMUSG00000020884
AA Change: S96R

DomainStartEndE-ValueType
Pfam:Lectin_N 6 143 1.1e-67 PFAM
CLECT 153 277 2.23e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108585
AA Change: S96R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104226
Gene: ENSMUSG00000020884
AA Change: S96R

DomainStartEndE-ValueType
Blast:GuKc 1 112 1e-24 BLAST
CLECT 124 248 2.23e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123369
SMART Domains Protein: ENSMUSP00000137469
Gene: ENSMUSG00000020884

DomainStartEndE-ValueType
Pfam:Lectin_N 1 43 2e-19 PFAM
CLECT 53 129 9.83e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146411
AA Change: S96R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000121842
Gene: ENSMUSG00000020884
AA Change: S96R

DomainStartEndE-ValueType
Pfam:Lectin_N 13 143 4.7e-55 PFAM
CLECT 153 277 2.23e-40 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the more abundant major subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired hepatic clearance of asialoglycoproteins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Asgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02651:Asgr1 APN 11 70057130 missense possibly damaging 0.65
R1371:Asgr1 UTSW 11 70056097 missense probably benign 0.04
R1471:Asgr1 UTSW 11 70056093 missense possibly damaging 0.82
R1980:Asgr1 UTSW 11 70054946 missense probably damaging 1.00
R2186:Asgr1 UTSW 11 70056249 missense probably benign 0.02
R5757:Asgr1 UTSW 11 70054952 missense probably benign 0.01
R6037:Asgr1 UTSW 11 70056421 missense probably benign 0.00
R6478:Asgr1 UTSW 11 70056894 missense possibly damaging 0.94
R6963:Asgr1 UTSW 11 70055968 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGATCTGCTGGCTCTAAGGC -3'
(R):5'- GAGATTTGGCCCCATGTCAG -3'

Sequencing Primer
(F):5'- GCTCTAAGGCAGAATTTCAGC -3'
(R):5'- GCCCCATGTCAGACCCCTC -3'
Posted On2017-08-16