Incidental Mutation 'R0537:Sec16b'
ID49479
Institutional Source Beutler Lab
Gene Symbol Sec16b
Ensembl Gene ENSMUSG00000026589
Gene NameSEC16 homolog B (S. cerevisiae)
SynonymsRgpr, Lztr2, Rgpr-p117
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0537 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location157506728-157568425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 157537546 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 335 (T335A)
Ref Sequence ENSEMBL: ENSMUSP00000107329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027881] [ENSMUST00000086130] [ENSMUST00000111700] [ENSMUST00000146873]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027881
AA Change: T335A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027881
Gene: ENSMUSG00000026589
AA Change: T335A

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 270 371 1.7e-19 PFAM
Pfam:Sec16_C 436 681 1e-38 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086130
AA Change: T335A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083300
Gene: ENSMUSG00000026589
AA Change: T335A

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 271 370 4.8e-8 PFAM
Pfam:Sec16_C 437 677 2.2e-45 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111700
AA Change: T335A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107329
Gene: ENSMUSG00000026589
AA Change: T335A

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 270 371 1.7e-19 PFAM
Pfam:Sec16_C 436 681 1e-38 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146873
AA Change: T146A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119359
Gene: ENSMUSG00000026589
AA Change: T146A

DomainStartEndE-ValueType
low complexity region 23 43 N/A INTRINSIC
Pfam:Sec16 81 182 9.4e-20 PFAM
Pfam:Sec16_C 247 492 4.8e-39 PFAM
low complexity region 606 621 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155665
Meta Mutation Damage Score 0.0670 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SEC16B is a mammalian homolog of S. cerevisiae Sec16 that is required for organization of transitional endoplasmic reticulum (ER) sites and protein export (Bhattacharyya and Glick, 2007 [PubMed 17192411]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Sec16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Sec16b APN 1 157538330 missense probably damaging 1.00
IGL00645:Sec16b APN 1 157566719 missense probably damaging 1.00
IGL00763:Sec16b APN 1 157529257 missense probably benign 0.00
IGL00822:Sec16b APN 1 157564555 missense probably benign 0.05
IGL02225:Sec16b APN 1 157532044 unclassified probably benign
IGL02746:Sec16b APN 1 157546289 splice site probably benign
IGL03031:Sec16b APN 1 157560799 missense probably benign
IGL03117:Sec16b APN 1 157535400 missense probably damaging 1.00
IGL03193:Sec16b APN 1 157535393 missense probably benign 0.01
R0206:Sec16b UTSW 1 157552935 nonsense probably null
R0208:Sec16b UTSW 1 157552935 nonsense probably null
R0349:Sec16b UTSW 1 157532176 splice site probably null
R0433:Sec16b UTSW 1 157534709 nonsense probably null
R0593:Sec16b UTSW 1 157532148 missense probably benign 0.03
R0629:Sec16b UTSW 1 157564863 unclassified probably benign
R1028:Sec16b UTSW 1 157560917 missense probably benign 0.03
R1119:Sec16b UTSW 1 157564834 missense possibly damaging 0.93
R1835:Sec16b UTSW 1 157531312 missense probably benign 0.00
R1894:Sec16b UTSW 1 157552975 missense possibly damaging 0.90
R2307:Sec16b UTSW 1 157535492 missense probably damaging 1.00
R3438:Sec16b UTSW 1 157556758 splice site probably benign
R4788:Sec16b UTSW 1 157561524 missense possibly damaging 0.77
R5109:Sec16b UTSW 1 157564791 nonsense probably null
R5235:Sec16b UTSW 1 157534764 missense probably benign 0.00
R5942:Sec16b UTSW 1 157531350 missense probably damaging 1.00
R6034:Sec16b UTSW 1 157552939 missense probably damaging 1.00
R6034:Sec16b UTSW 1 157552939 missense probably damaging 1.00
R6081:Sec16b UTSW 1 157560754 missense probably benign
R7026:Sec16b UTSW 1 157534711 missense possibly damaging 0.80
R7192:Sec16b UTSW 1 157529443 missense probably benign 0.00
R7270:Sec16b UTSW 1 157564462 missense probably damaging 1.00
R7270:Sec16b UTSW 1 157564463 missense probably damaging 1.00
R7404:Sec16b UTSW 1 157531357 missense probably damaging 1.00
R7494:Sec16b UTSW 1 157560799 missense probably benign
R7570:Sec16b UTSW 1 157531395 splice site probably null
R7747:Sec16b UTSW 1 157565472 missense possibly damaging 0.69
R7751:Sec16b UTSW 1 157558060 missense probably damaging 1.00
R7797:Sec16b UTSW 1 157561675 missense unknown
R7913:Sec16b UTSW 1 157529329 missense probably benign 0.00
R7943:Sec16b UTSW 1 157554757 missense probably benign
R8176:Sec16b UTSW 1 157535411 missense probably damaging 1.00
Z1088:Sec16b UTSW 1 157558024 splice site probably null
Z1176:Sec16b UTSW 1 157551069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGATCTTGCGATTCCAGACTTCC -3'
(R):5'- TGGCACACCAGTGTTAGAACCG -3'

Sequencing Primer
(F):5'- GCGATTCCAGACTTCCAGTCC -3'
(R):5'- GTGTTAGAACCGGAGCTACACTC -3'
Posted On2013-06-12