Mutagenetix > Incidental Mutation

Incidental Mutation 'R5083:Slfn10-ps'

500853

Institutional Source

Beutler Lab

Gene Symbol

Slfn10-ps

Ensembl Gene

ENSMUSG00000072621

Gene Name

schlafen 10, pseudogene

Synonyms

MMRRC Submission

042672-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R5083 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82919681-82926992 bp(-) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to A at 82921341 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100716

SMART Domains

Protein: ENSMUSP00000098282
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	142	278	1.3e-13	PFAM
Pfam:DUF2075	529	697	1.6e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119608

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152760

SMART Domains

Protein: ENSMUSP00000130353
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AAA_4	142	280	1.8e-14	PFAM
Pfam:DUF2075	529	693	1.8e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185158

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	C	T	17: 48,473,558 (GRCm39)	V120M	possibly damaging	Het
Abca6	T	C	11: 110,109,793 (GRCm39)	D646G	probably damaging	Het
Agbl5	G	A	5: 31,060,403 (GRCm39)	R141Q	probably damaging	Het
Arid1b	A	G	17: 5,364,293 (GRCm39)	T554A	possibly damaging	Het
Atp2a3	G	T	11: 72,873,652 (GRCm39)	V824L	probably null	Het
Bet1	T	C	6: 4,077,895 (GRCm39)	I115V	possibly damaging	Het
Cdc23	C	A	18: 34,784,742 (GRCm39)	V7L	unknown	Het
Cfap65	A	G	1: 74,945,600 (GRCm39)	S1373P	probably damaging	Het
Chd9	T	C	8: 91,711,002 (GRCm39)	L353P	probably damaging	Het
Chil3	C	A	3: 106,071,405 (GRCm39)		probably null	Het
Comp	C	T	8: 70,833,950 (GRCm39)	T655M	probably damaging	Het
Dctd	T	C	8: 48,564,751 (GRCm39)	Y18H	probably damaging	Het
Ddx39b	G	A	17: 35,472,005 (GRCm39)	G348D	possibly damaging	Het
Dhx36	A	T	3: 62,379,420 (GRCm39)	S889R	probably benign	Het
Dtx2	T	C	5: 136,041,044 (GRCm39)	Y150H	probably damaging	Het
Epx	A	G	11: 87,763,506 (GRCm39)	F238S	probably damaging	Het
Ergic2	T	C	6: 148,097,512 (GRCm39)	T154A	probably benign	Het
Esco1	A	G	18: 10,594,734 (GRCm39)	I184T	probably benign	Het
Esf1	G	T	2: 139,998,991 (GRCm39)	A495E	possibly damaging	Het
Esf1	T	C	2: 140,000,499 (GRCm39)	Y429C	possibly damaging	Het
Fcho1	C	A	8: 72,169,820 (GRCm39)	R101L	probably benign	Het
Foxn4	T	A	5: 114,394,988 (GRCm39)	D313V	probably damaging	Het
Gm11568	T	C	11: 99,748,798 (GRCm39)	M1T	probably null	Het
Gphn	T	A	12: 78,670,063 (GRCm39)		probably null	Het
Grid2	C	T	6: 64,297,136 (GRCm39)	Q500*	probably null	Het
Igsf10	A	G	3: 59,233,694 (GRCm39)	S1680P	probably damaging	Het
Ints12	T	C	3: 132,806,538 (GRCm39)	M155T	possibly damaging	Het
Invs	A	T	4: 48,396,307 (GRCm39)	M327L	possibly damaging	Het
Kdm3a	T	C	6: 71,598,346 (GRCm39)	E180G	probably damaging	Het
Mgat3	G	A	15: 80,095,499 (GRCm39)	V109M	possibly damaging	Het
Mrgprb3	A	G	7: 48,292,762 (GRCm39)	V263A	probably benign	Het
Mroh7	A	T	4: 106,547,515 (GRCm39)	V1109D	probably benign	Het
Myo15b	A	T	11: 115,757,482 (GRCm39)	T1111S	probably benign	Het
Myo19	G	T	11: 84,794,037 (GRCm39)	A654S	possibly damaging	Het
Mypn	A	T	10: 62,954,307 (GRCm39)	V1224D	probably damaging	Het
Nalcn	A	G	14: 123,560,706 (GRCm39)		probably null	Het
Or2a52	G	T	6: 43,144,273 (GRCm39)	A94S	probably benign	Het
Or52e7	A	T	7: 104,684,618 (GRCm39)	Y71F	probably damaging	Het
Or8c10	G	A	9: 38,279,358 (GRCm39)	C172Y	possibly damaging	Het
Pdcd2	A	G	17: 15,743,084 (GRCm39)	I247T	possibly damaging	Het
Pik3c2a	A	T	7: 115,941,636 (GRCm39)	N1571K	probably damaging	Het
Plagl2	T	C	2: 153,077,964 (GRCm39)	T6A	probably benign	Het
Ros1	T	A	10: 52,040,037 (GRCm39)	Y318F	possibly damaging	Het
Sdccag8	C	A	1: 176,652,458 (GRCm39)	H70N	probably damaging	Het
Skint1	A	G	4: 111,886,630 (GRCm39)	R359G	probably benign	Het
Slc44a5	A	T	3: 153,953,424 (GRCm39)	I269L	probably benign	Het
Suclg1	C	A	6: 73,240,963 (GRCm39)	T164K	probably benign	Het
Tgds	C	A	14: 118,353,491 (GRCm39)		probably null	Het
Ttn	T	C	2: 76,643,877 (GRCm39)	D13117G	probably damaging	Het
Ttn	T	C	2: 76,701,081 (GRCm39)		probably benign	Het
Vmn2r28	A	T	7: 5,483,671 (GRCm39)	I843N	possibly damaging	Het
Vmn2r52	A	T	7: 9,893,392 (GRCm39)	Y582*	probably null	Het
Vps33b	G	T	7: 79,924,389 (GRCm39)	K65N	probably damaging	Het
Zfp1010	A	G	2: 176,957,364 (GRCm39)	F45L	probably damaging	Het

Other mutations in Slfn10-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00773:Slfn10-ps	APN	11	82,926,355 (GRCm39)	unclassified	noncoding transcript
IGL00826:Slfn10-ps	APN	11	82,926,085 (GRCm39)	unclassified	noncoding transcript
IGL01022:Slfn10-ps	APN	11	82,926,353 (GRCm39)	unclassified	noncoding transcript
IGL01409:Slfn10-ps	APN	11	82,926,322 (GRCm39)	unclassified	noncoding transcript
IGL01664:Slfn10-ps	APN	11	82,926,761 (GRCm39)	unclassified	noncoding transcript
IGL01700:Slfn10-ps	APN	11	82,919,938 (GRCm39)	unclassified	noncoding transcript
IGL02093:Slfn10-ps	APN	11	82,923,016 (GRCm39)	unclassified	noncoding transcript
IGL02253:Slfn10-ps	APN	11	82,919,890 (GRCm39)	unclassified	noncoding transcript
IGL02364:Slfn10-ps	APN	11	82,923,117 (GRCm39)	unclassified	noncoding transcript
IGL02466:Slfn10-ps	APN	11	82,921,090 (GRCm39)	unclassified	noncoding transcript
IGL02636:Slfn10-ps	APN	11	82,920,971 (GRCm39)	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	82,921,126 (GRCm39)	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	82,921,126 (GRCm39)	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	82,926,368 (GRCm39)	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	82,926,368 (GRCm39)	unclassified	noncoding transcript
R0164:Slfn10-ps	UTSW	11	82,926,128 (GRCm39)	unclassified	noncoding transcript
R0362:Slfn10-ps	UTSW	11	82,926,600 (GRCm39)	unclassified	noncoding transcript
R0382:Slfn10-ps	UTSW	11	82,920,360 (GRCm39)	unclassified	noncoding transcript
R0597:Slfn10-ps	UTSW	11	82,926,479 (GRCm39)	unclassified	noncoding transcript
R0812:Slfn10-ps	UTSW	11	82,926,388 (GRCm39)	unclassified	noncoding transcript
R0904:Slfn10-ps	UTSW	11	82,926,235 (GRCm39)	unclassified	noncoding transcript
R1552:Slfn10-ps	UTSW	11	82,920,676 (GRCm39)	unclassified	noncoding transcript
R1703:Slfn10-ps	UTSW	11	82,920,869 (GRCm39)	unclassified	noncoding transcript
R2127:Slfn10-ps	UTSW	11	82,921,168 (GRCm39)	unclassified	noncoding transcript
R2151:Slfn10-ps	UTSW	11	82,926,511 (GRCm39)	unclassified	noncoding transcript
R2302:Slfn10-ps	UTSW	11	82,919,756 (GRCm39)	unclassified	noncoding transcript
R3114:Slfn10-ps	UTSW	11	82,919,955 (GRCm39)	unclassified	noncoding transcript
R4293:Slfn10-ps	UTSW	11	82,926,260 (GRCm39)	unclassified	noncoding transcript
R4929:Slfn10-ps	UTSW	11	82,920,345 (GRCm39)	unclassified	noncoding transcript
R4970:Slfn10-ps	UTSW	11	82,921,207 (GRCm39)	unclassified	noncoding transcript
R5290:Slfn10-ps	UTSW	11	82,919,851 (GRCm39)	unclassified	noncoding transcript
R5306:Slfn10-ps	UTSW	11	82,926,355 (GRCm39)	unclassified	noncoding transcript
R5444:Slfn10-ps	UTSW	11	82,926,113 (GRCm39)	unclassified	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- GCTTCTCTTCCAGGTTCAGG -3'
(R):5'- CGTGCCATACTCAACTGGAC -3'

Sequencing Primer
(F):5'- TTCCAGGTTCAGGTCCACAG -3'
(R):5'- TTCTCGCGTTAGAAAATAAACAGGCG -3'

Posted On

2017-12-01