Incidental Mutation 'R6267:Ms4a7'
ID507125
Institutional Source Beutler Lab
Gene Symbol Ms4a7
Ensembl Gene ENSMUSG00000024672
Gene Namemembrane-spanning 4-domains, subfamily A, member 7
Synonyms9130422I10Rik, CD20l4, CFFMA, A430103C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R6267 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location11321039-11336146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11333295 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 20 (I20N)
Ref Sequence ENSEMBL: ENSMUSP00000054830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025574] [ENSMUST00000056035] [ENSMUST00000067532]
Predicted Effect probably benign
Transcript: ENSMUST00000025574
AA Change: I53N

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025574
Gene: ENSMUSG00000024672
AA Change: I53N

DomainStartEndE-ValueType
Pfam:CD20 80 237 4.6e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000056035
AA Change: I20N

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054830
Gene: ENSMUSG00000024672
AA Change: I20N

DomainStartEndE-ValueType
transmembrane domain 53 72 N/A INTRINSIC
Pfam:CD20 92 185 3.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067532
AA Change: I20N

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000064534
Gene: ENSMUSG00000024672
AA Change: I20N

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.9e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162785
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-spanning 4A gene family, members of which are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. This family member is associated with mature cellular function in the monocytic lineage, and it may be a component of a receptor complex involved in signal transduction. This gene is localized to 11q12, in a cluster of other family members. At least four alternatively spliced transcript variants encoding two distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Abi3bp A G 16: 56,594,497 T341A probably damaging Het
Acer2 T C 4: 86,874,586 F33S probably damaging Het
Actr1b A G 1: 36,701,163 V299A possibly damaging Het
Ampd3 T A 7: 110,791,180 probably null Het
Atm A C 9: 53,444,000 I2898R probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Chd2 T C 7: 73,463,671 E1187G probably damaging Het
Cntrl T C 2: 35,129,793 L544P probably damaging Het
Cryga A C 1: 65,103,010 S75A probably benign Het
Dcbld1 T A 10: 52,319,480 Y261* probably null Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dst A C 1: 34,228,672 D5065A probably damaging Het
Dusp16 C A 6: 134,720,493 probably null Het
Eif4enif1 T A 11: 3,227,793 V395E probably damaging Het
Enox1 A G 14: 77,577,764 T121A probably damaging Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Fcrl5 G A 3: 87,448,324 G448E probably damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Garnl3 T C 2: 33,104,880 D39G probably benign Het
Gm14295 C T 2: 176,808,989 Q91* probably null Het
Grb10 T A 11: 11,970,639 probably benign Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Herc2 T A 7: 56,153,166 C2112* probably null Het
Herc2 T G 7: 56,204,718 L3797R possibly damaging Het
Ighm T C 12: 113,421,567 I258V unknown Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kif13b A G 14: 64,738,634 Y466C probably damaging Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lingo4 G A 3: 94,403,390 G545E probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lor C A 3: 92,081,812 G56* probably null Het
Lrfn1 A G 7: 28,459,744 R363G probably benign Het
Lrp1b T C 2: 40,657,525 D446G probably benign Het
Ltbp1 G T 17: 75,005,989 G35V possibly damaging Het
Magel2 G A 7: 62,378,679 V444M probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Myo5b A G 18: 74,616,991 Y173C probably damaging Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nmnat2 A T 1: 153,076,971 H102L probably damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr686 G A 7: 105,203,392 T317I probably damaging Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Pitpnm1 T C 19: 4,110,522 L781P probably damaging Het
Prdm14 A T 1: 13,118,936 C395S probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rorb C A 19: 18,977,857 V47L possibly damaging Het
Rtn4r A G 16: 18,151,182 Y158C probably damaging Het
Sdr16c5 C T 4: 4,016,162 G88E probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Slc52a3 G T 2: 152,007,609 probably null Het
Smco1 A T 16: 32,274,014 M168L probably benign Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Tmem225 T A 9: 40,148,435 I37N probably damaging Het
Unkl T C 17: 25,231,865 *232R probably null Het
Usp16 A G 16: 87,483,191 N813S probably benign Het
Vmn1r128 A T 7: 21,350,296 *308C probably null Het
Vmn2r45 A G 7: 8,472,208 V607A probably benign Het
Vmn2r63 A T 7: 42,928,635 probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Ms4a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Ms4a7 APN 19 11322360 missense probably damaging 0.98
IGL01845:Ms4a7 APN 19 11322387 missense possibly damaging 0.86
IGL02409:Ms4a7 APN 19 11324443 nonsense probably null
R1851:Ms4a7 UTSW 19 11324424 missense probably benign 0.08
R5426:Ms4a7 UTSW 19 11325802 splice site probably null
R5468:Ms4a7 UTSW 19 11322414 missense probably benign 0.39
R6756:Ms4a7 UTSW 19 11324525 missense possibly damaging 0.93
R6990:Ms4a7 UTSW 19 11333241 missense probably damaging 0.99
R7260:Ms4a7 UTSW 19 11322346 missense probably damaging 1.00
R7272:Ms4a7 UTSW 19 11333278 nonsense probably null
R7397:Ms4a7 UTSW 19 11321552 missense probably benign 0.16
R7678:Ms4a7 UTSW 19 11324504 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAAAACAGGTCAAGGATTCTTCC -3'
(R):5'- GGTCATCCAACCCTGAATGTAC -3'

Sequencing Primer
(F):5'- CAGGTCAAGGATTCTTCCAGATTCAC -3'
(R):5'- AACCCTGAATGTACTCAATTCTTACC -3'
Posted On2018-03-15