Incidental Mutation 'R6990:Ms4a7'
ID543221
Institutional Source Beutler Lab
Gene Symbol Ms4a7
Ensembl Gene ENSMUSG00000024672
Gene Namemembrane-spanning 4-domains, subfamily A, member 7
Synonyms9130422I10Rik, CD20l4, CFFMA, A430103C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location11321039-11336146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11333241 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 38 (L38Q)
Ref Sequence ENSEMBL: ENSMUSP00000054830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025574] [ENSMUST00000056035] [ENSMUST00000067532]
Predicted Effect probably benign
Transcript: ENSMUST00000025574
AA Change: L71Q

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025574
Gene: ENSMUSG00000024672
AA Change: L71Q

DomainStartEndE-ValueType
Pfam:CD20 80 237 4.6e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056035
AA Change: L38Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054830
Gene: ENSMUSG00000024672
AA Change: L38Q

DomainStartEndE-ValueType
transmembrane domain 53 72 N/A INTRINSIC
Pfam:CD20 92 185 3.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067532
AA Change: L38Q

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000064534
Gene: ENSMUSG00000024672
AA Change: L38Q

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.9e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-spanning 4A gene family, members of which are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. This family member is associated with mature cellular function in the monocytic lineage, and it may be a component of a receptor complex involved in signal transduction. This gene is localized to 11q12, in a cluster of other family members. At least four alternatively spliced transcript variants encoding two distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Ms4a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Ms4a7 APN 19 11322360 missense probably damaging 0.98
IGL01845:Ms4a7 APN 19 11322387 missense possibly damaging 0.86
IGL02409:Ms4a7 APN 19 11324443 nonsense probably null
R1851:Ms4a7 UTSW 19 11324424 missense probably benign 0.08
R5426:Ms4a7 UTSW 19 11325802 splice site probably null
R5468:Ms4a7 UTSW 19 11322414 missense probably benign 0.39
R6267:Ms4a7 UTSW 19 11333295 missense possibly damaging 0.88
R6756:Ms4a7 UTSW 19 11324525 missense possibly damaging 0.93
R7260:Ms4a7 UTSW 19 11322346 missense probably damaging 1.00
R7272:Ms4a7 UTSW 19 11333278 nonsense probably null
R7397:Ms4a7 UTSW 19 11321552 missense probably benign 0.16
R7678:Ms4a7 UTSW 19 11324504 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGTTCTGGTGGAAAAGCAC -3'
(R):5'- GTCAAACCCTGGGGACTAAC -3'

Sequencing Primer
(F):5'- TTATTTTAAATGAAGGCCCAAGGAGG -3'
(R):5'- ACTAACTGAGTCCATTGCCTC -3'
Posted On2018-11-28