Incidental Mutation 'R6267:Vmn2r45'
ID 507068
Institutional Source Beutler Lab
Gene Symbol Vmn2r45
Ensembl Gene ENSMUSG00000090662
Gene Name vomeronasal 2, receptor 45
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R6267 (G1)
Quality Score 148.008
Status Not validated
Chromosome 7
Chromosomal Location 8470525-8489075 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8472208 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 607 (V607A)
Ref Sequence ENSEMBL: ENSMUSP00000129466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164845]
AlphaFold L7N2B5
Predicted Effect probably benign
Transcript: ENSMUST00000164845
AA Change: V607A

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129466
Gene: ENSMUSG00000090662
AA Change: V607A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 154 469 4.5e-26 PFAM
Pfam:NCD3G 512 565 6.4e-21 PFAM
Pfam:7tm_3 598 833 2.1e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Abi3bp A G 16: 56,594,497 T341A probably damaging Het
Acer2 T C 4: 86,874,586 F33S probably damaging Het
Actr1b A G 1: 36,701,163 V299A possibly damaging Het
Ampd3 T A 7: 110,791,180 probably null Het
Atm A C 9: 53,444,000 I2898R probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Chd2 T C 7: 73,463,671 E1187G probably damaging Het
Cntrl T C 2: 35,129,793 L544P probably damaging Het
Cryga A C 1: 65,103,010 S75A probably benign Het
Dcbld1 T A 10: 52,319,480 Y261* probably null Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dst A C 1: 34,228,672 D5065A probably damaging Het
Dusp16 C A 6: 134,720,493 probably null Het
Eif4enif1 T A 11: 3,227,793 V395E probably damaging Het
Enox1 A G 14: 77,577,764 T121A probably damaging Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Fcrl5 G A 3: 87,448,324 G448E probably damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Garnl3 T C 2: 33,104,880 D39G probably benign Het
Gm14295 C T 2: 176,808,989 Q91* probably null Het
Grb10 T A 11: 11,970,639 probably benign Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Herc2 T A 7: 56,153,166 C2112* probably null Het
Herc2 T G 7: 56,204,718 L3797R possibly damaging Het
Ighm T C 12: 113,421,567 I258V unknown Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kif13b A G 14: 64,738,634 Y466C probably damaging Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lingo4 G A 3: 94,403,390 G545E probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lor C A 3: 92,081,812 G56* probably null Het
Lrfn1 A G 7: 28,459,744 R363G probably benign Het
Lrp1b T C 2: 40,657,525 D446G probably benign Het
Ltbp1 G T 17: 75,005,989 G35V possibly damaging Het
Magel2 G A 7: 62,378,679 V444M probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Ms4a7 A T 19: 11,333,295 I20N possibly damaging Het
Myo5b A G 18: 74,616,991 Y173C probably damaging Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nmnat2 A T 1: 153,076,971 H102L probably damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr686 G A 7: 105,203,392 T317I probably damaging Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Pitpnm1 T C 19: 4,110,522 L781P probably damaging Het
Prdm14 A T 1: 13,118,936 C395S probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rorb C A 19: 18,977,857 V47L possibly damaging Het
Rtn4r A G 16: 18,151,182 Y158C probably damaging Het
Sdr16c5 C T 4: 4,016,162 G88E probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Slc52a3 G T 2: 152,007,609 probably null Het
Smco1 A T 16: 32,274,014 M168L probably benign Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Tmem225 T A 9: 40,148,435 I37N probably damaging Het
Unkl T C 17: 25,231,865 *232R probably null Het
Usp16 A G 16: 87,483,191 N813S probably benign Het
Vmn1r128 A T 7: 21,350,296 *308C probably null Het
Vmn2r63 A T 7: 42,928,635 probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Vmn2r45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Vmn2r45 APN 7 8485623 missense probably benign 0.00
IGL01322:Vmn2r45 APN 7 8481333 missense possibly damaging 0.49
IGL01402:Vmn2r45 APN 7 8481468 missense probably damaging 0.98
IGL01404:Vmn2r45 APN 7 8481468 missense probably damaging 0.98
IGL01529:Vmn2r45 APN 7 8483494 missense probably benign
IGL01596:Vmn2r45 APN 7 8483273 missense probably damaging 0.98
IGL01646:Vmn2r45 APN 7 8483338 missense probably benign 0.18
IGL01819:Vmn2r45 APN 7 8485557 missense probably benign 0.00
IGL02096:Vmn2r45 APN 7 8481444 missense probably damaging 0.99
IGL02130:Vmn2r45 APN 7 8483557 missense possibly damaging 0.46
IGL02409:Vmn2r45 APN 7 8485728 missense probably benign 0.03
IGL02517:Vmn2r45 APN 7 8483186 nonsense probably null
IGL02633:Vmn2r45 APN 7 8485729 missense probably benign 0.01
IGL02940:Vmn2r45 APN 7 8472370 missense probably damaging 0.99
IGL03281:Vmn2r45 APN 7 8483604 missense probably damaging 1.00
IGL03358:Vmn2r45 APN 7 8471716 missense probably damaging 1.00
BB004:Vmn2r45 UTSW 7 8483514 missense probably benign
BB014:Vmn2r45 UTSW 7 8483514 missense probably benign
R0382:Vmn2r45 UTSW 7 8483099 missense probably benign 0.06
R0532:Vmn2r45 UTSW 7 8471821 missense probably damaging 0.99
R0932:Vmn2r45 UTSW 7 8475381 missense probably damaging 1.00
R1125:Vmn2r45 UTSW 7 8485543 missense probably benign 0.00
R1580:Vmn2r45 UTSW 7 8471747 missense possibly damaging 0.95
R1817:Vmn2r45 UTSW 7 8472373 missense probably damaging 1.00
R1996:Vmn2r45 UTSW 7 8472025 missense probably damaging 1.00
R2050:Vmn2r45 UTSW 7 8472022 missense probably damaging 1.00
R2284:Vmn2r45 UTSW 7 8485766 missense probably benign 0.02
R4019:Vmn2r45 UTSW 7 8471581 nonsense probably null
R4227:Vmn2r45 UTSW 7 8483278 missense probably damaging 0.98
R4381:Vmn2r45 UTSW 7 8471913 nonsense probably null
R4618:Vmn2r45 UTSW 7 8483437 missense probably benign 0.00
R4624:Vmn2r45 UTSW 7 8481342 missense probably damaging 1.00
R4704:Vmn2r45 UTSW 7 8483536 nonsense probably null
R4735:Vmn2r45 UTSW 7 8483473 missense probably damaging 1.00
R4868:Vmn2r45 UTSW 7 8481481 missense probably benign 0.06
R4983:Vmn2r45 UTSW 7 8483117 missense probably damaging 0.99
R5246:Vmn2r45 UTSW 7 8483252 missense probably benign 0.00
R5430:Vmn2r45 UTSW 7 8483334 nonsense probably null
R5504:Vmn2r45 UTSW 7 8483177 missense probably benign 0.03
R5511:Vmn2r45 UTSW 7 8471833 missense probably benign 0.19
R5745:Vmn2r45 UTSW 7 8483075 missense probably benign 0.00
R5814:Vmn2r45 UTSW 7 8471476 missense probably benign 0.00
R6223:Vmn2r45 UTSW 7 8483302 missense probably benign
R6623:Vmn2r45 UTSW 7 8471501 missense probably benign 0.09
R6999:Vmn2r45 UTSW 7 8483220 missense probably benign
R7242:Vmn2r45 UTSW 7 8485613 nonsense probably null
R7491:Vmn2r45 UTSW 7 8481343 missense probably benign 0.27
R7620:Vmn2r45 UTSW 7 8483223 nonsense probably null
R7719:Vmn2r45 UTSW 7 8483461 missense probably damaging 0.99
R7720:Vmn2r45 UTSW 7 8483461 missense probably damaging 0.99
R7853:Vmn2r45 UTSW 7 8482988 missense possibly damaging 0.90
R7873:Vmn2r45 UTSW 7 8483075 missense probably benign 0.00
R7882:Vmn2r45 UTSW 7 8483410 missense possibly damaging 0.82
R7927:Vmn2r45 UTSW 7 8483514 missense probably benign
R8684:Vmn2r45 UTSW 7 8483512 missense probably damaging 0.99
R8780:Vmn2r45 UTSW 7 8481372 missense possibly damaging 0.94
R8811:Vmn2r45 UTSW 7 8471882 missense probably damaging 1.00
R8893:Vmn2r45 UTSW 7 8485620 missense probably damaging 1.00
R9043:Vmn2r45 UTSW 7 8471905 missense possibly damaging 0.92
R9208:Vmn2r45 UTSW 7 8483299 missense probably damaging 1.00
R9327:Vmn2r45 UTSW 7 8471533 missense probably damaging 1.00
R9586:Vmn2r45 UTSW 7 8483051 missense probably benign 0.01
R9599:Vmn2r45 UTSW 7 8475458 critical splice acceptor site probably null
U24488:Vmn2r45 UTSW 7 8472362 missense probably damaging 1.00
Z1088:Vmn2r45 UTSW 7 8471485 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GACTGTTTTGGCCAGAACTGTG -3'
(R):5'- AGCAGACCTAACTAAGCTTTCC -3'

Sequencing Primer
(F):5'- TTTTGGCCAGAACTGTGGAAAG -3'
(R):5'- GCAGACCTAACTAAGCTTTCCTTTGG -3'
Posted On 2018-03-15