Incidental Mutation 'R6312:Vmn1r62'
ID509810
Institutional Source Beutler Lab
Gene Symbol Vmn1r62
Ensembl Gene ENSMUSG00000092579
Gene Namevomeronasal 1 receptor 62
SynonymsV1rd2, V1rd8, V3R2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R6312 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location5674627-5676383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5676084 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 255 (V255M)
Ref Sequence ENSEMBL: ENSMUSP00000134168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173956]
Predicted Effect possibly damaging
Transcript: ENSMUST00000173956
AA Change: V255M

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134168
Gene: ENSMUSG00000092579
AA Change: V255M

DomainStartEndE-ValueType
Pfam:TAS2R 1 296 2.8e-11 PFAM
Pfam:7tm_1 20 279 3.1e-6 PFAM
Pfam:V1R 31 299 4.2e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Vmn1r62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Vmn1r62 APN 7 5676145 missense probably damaging 1.00
IGL01650:Vmn1r62 APN 7 5676025 missense probably damaging 1.00
IGL02892:Vmn1r62 APN 7 5676203 missense probably benign
IGL02970:Vmn1r62 APN 7 5675568 missense possibly damaging 0.64
IGL03282:Vmn1r62 APN 7 5675548 missense possibly damaging 0.93
R0470:Vmn1r62 UTSW 7 5676067 nonsense probably null
R1416:Vmn1r62 UTSW 7 5675905 missense probably damaging 1.00
R2149:Vmn1r62 UTSW 7 5675359 missense probably benign 0.18
R4093:Vmn1r62 UTSW 7 5675944 missense probably damaging 0.96
R4596:Vmn1r62 UTSW 7 5675307 start gained probably benign
R4809:Vmn1r62 UTSW 7 5675867 missense probably benign 0.41
R5669:Vmn1r62 UTSW 7 5675737 nonsense probably null
R6262:Vmn1r62 UTSW 7 5675557 missense probably damaging 1.00
R6548:Vmn1r62 UTSW 7 5675770 missense probably damaging 1.00
R7624:Vmn1r62 UTSW 7 5675601 missense probably benign 0.01
R7710:Vmn1r62 UTSW 7 5675183 start gained probably benign
R7896:Vmn1r62 UTSW 7 5675610 missense probably damaging 1.00
R8117:Vmn1r62 UTSW 7 5675727 missense possibly damaging 0.62
R8673:Vmn1r62 UTSW 7 5675278 start gained probably benign
R8714:Vmn1r62 UTSW 7 5675630 nonsense probably null
RF007:Vmn1r62 UTSW 7 5675670 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATATTCCTAAGCATCATGGCCTGG -3'
(R):5'- GGGTTTAGACATGTTTTGACCC -3'

Sequencing Primer
(F):5'- TAAGCATCATGGCCTGGACCAG -3'
(R):5'- GTTTAGACATGTTTTGACCCTACTG -3'
Posted On2018-04-02