Incidental Mutation 'R6312:Zfp60'
ID509813
Institutional Source Beutler Lab
Gene Symbol Zfp60
Ensembl Gene ENSMUSG00000037640
Gene Namezinc finger protein 60
Synonyms6330516O17Rik, Mfg-3, Mfg3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6312 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27731389-27753702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27748776 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 290 (C290R)
Ref Sequence ENSEMBL: ENSMUSP00000132607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042641] [ENSMUST00000108336] [ENSMUST00000130997] [ENSMUST00000136373] [ENSMUST00000167955]
Predicted Effect probably damaging
Transcript: ENSMUST00000042641
AA Change: C290R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036627
Gene: ENSMUSG00000037640
AA Change: C290R

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108336
AA Change: C290R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103973
Gene: ENSMUSG00000037640
AA Change: C290R

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130997
SMART Domains Protein: ENSMUSP00000118469
Gene: ENSMUSG00000037640

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136373
SMART Domains Protein: ENSMUSP00000117049
Gene: ENSMUSG00000037640

DomainStartEndE-ValueType
KRAB 14 55 3.2e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167955
AA Change: C290R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132607
Gene: ENSMUSG00000037640
AA Change: C290R

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Zfp60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03353:Zfp60 APN 7 27748334 nonsense probably null
PIT4494001:Zfp60 UTSW 7 27748701 missense probably damaging 1.00
R1281:Zfp60 UTSW 7 27738427 missense probably damaging 1.00
R1643:Zfp60 UTSW 7 27736975 missense probably damaging 0.98
R1883:Zfp60 UTSW 7 27750010 missense probably benign 0.00
R1930:Zfp60 UTSW 7 27736957 start codon destroyed probably null 1.00
R3623:Zfp60 UTSW 7 27749328 missense probably benign 0.01
R3624:Zfp60 UTSW 7 27749328 missense probably benign 0.01
R3875:Zfp60 UTSW 7 27749581 missense probably damaging 1.00
R5296:Zfp60 UTSW 7 27738530 intron probably benign
R5491:Zfp60 UTSW 7 27748515 splice site probably null
R5724:Zfp60 UTSW 7 27748333 missense probably benign
R6134:Zfp60 UTSW 7 27749898 missense probably benign 0.01
R6477:Zfp60 UTSW 7 27749803 missense probably benign 0.00
R6649:Zfp60 UTSW 7 27748726 missense probably benign 0.00
R6653:Zfp60 UTSW 7 27748726 missense probably benign 0.00
R7041:Zfp60 UTSW 7 27749026 missense probably benign 0.05
R7166:Zfp60 UTSW 7 27749512 missense possibly damaging 0.82
R7185:Zfp60 UTSW 7 27738405 missense probably damaging 1.00
R7334:Zfp60 UTSW 7 27749019 missense probably damaging 1.00
R7560:Zfp60 UTSW 7 27749136 missense probably damaging 0.99
R7560:Zfp60 UTSW 7 27749271 missense probably damaging 1.00
R7561:Zfp60 UTSW 7 27748530 missense probably damaging 1.00
R7673:Zfp60 UTSW 7 27748315 missense probably benign 0.00
R7961:Zfp60 UTSW 7 27748456 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCTACTTACACTAGCAAGACTCTTG -3'
(R):5'- TTACCACACTGCTTACATTCAAACG -3'

Sequencing Primer
(F):5'- ACTGTGGGAAGACCTTCAGACTC -3'
(R):5'- TCAAACGATTTGTCTTCAGTGTG -3'
Posted On2018-04-02