Incidental Mutation 'R6327:Olfr292'
ID510471
Institutional Source Beutler Lab
Gene Symbol Olfr292
Ensembl Gene ENSMUSG00000060688
Gene Nameolfactory receptor 292
SynonymsGA_x6K02T2NHDJ-9425121-9424195, MOR220-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6327 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86688330-86697507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86694552 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 32 (V32A)
Ref Sequence ENSEMBL: ENSMUSP00000079060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080165]
Predicted Effect probably benign
Transcript: ENSMUST00000080165
AA Change: V32A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000079060
Gene: ENSMUSG00000060688
AA Change: V32A

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 2.6e-48 PFAM
Pfam:7tm_1 39 288 2.7e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
C3ar1 C T 6: 122,850,146 V371M probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Ckap2l A G 2: 129,285,494 S255P probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dld G A 12: 31,332,191 P506S probably benign Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Ehd1 T C 19: 6,298,345 I451T possibly damaging Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nisch A T 14: 31,171,487 probably benign Het
Nudt17 T C 3: 96,707,764 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Oprm1 A C 10: 6,830,063 I242L probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pamr1 A T 2: 102,642,174 D606V probably damaging Het
Pcf11 T C 7: 92,659,609 probably benign Het
Pom121l2 T C 13: 21,982,332 S258P probably damaging Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Serpinf1 A G 11: 75,413,905 probably null Het
Slc22a30 T G 19: 8,335,722 probably benign Het
Strn4 G T 7: 16,816,459 S36I probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in Olfr292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Olfr292 APN 7 86695293 missense probably benign 0.10
IGL01751:Olfr292 APN 7 86694789 missense probably benign
IGL02417:Olfr292 APN 7 86694819 missense probably damaging 1.00
IGL02534:Olfr292 APN 7 86694731 missense probably benign 0.17
IGL02830:Olfr292 APN 7 86695174 missense probably damaging 1.00
R0281:Olfr292 UTSW 7 86694860 missense probably benign 0.00
R0423:Olfr292 UTSW 7 86695226 missense possibly damaging 0.95
R0555:Olfr292 UTSW 7 86695308 missense probably damaging 1.00
R0609:Olfr292 UTSW 7 86694876 missense possibly damaging 0.85
R0662:Olfr292 UTSW 7 86694630 missense possibly damaging 0.88
R1710:Olfr292 UTSW 7 86695110 missense probably benign 0.00
R2144:Olfr292 UTSW 7 86695280 missense probably damaging 0.98
R4400:Olfr292 UTSW 7 86694590 missense probably benign 0.10
R4615:Olfr292 UTSW 7 86694728 missense probably damaging 1.00
R4762:Olfr292 UTSW 7 86695121 missense probably benign 0.01
R4785:Olfr292 UTSW 7 86694528 missense probably damaging 1.00
R4823:Olfr292 UTSW 7 86694588 missense probably damaging 0.99
R4908:Olfr292 UTSW 7 86695187 missense probably benign 0.00
R4983:Olfr292 UTSW 7 86694479 missense probably benign 0.01
R5010:Olfr292 UTSW 7 86694585 missense possibly damaging 0.95
R5024:Olfr292 UTSW 7 86694881 missense probably benign 0.05
R5157:Olfr292 UTSW 7 86695232 missense probably benign 0.19
R5627:Olfr292 UTSW 7 86695139 missense possibly damaging 0.93
R6375:Olfr292 UTSW 7 86695059 missense probably benign 0.01
R6775:Olfr292 UTSW 7 86695149 missense probably benign 0.02
R7257:Olfr292 UTSW 7 86694804 missense probably damaging 0.99
R7383:Olfr292 UTSW 7 86694752 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTTTCAAGAGAAATGCTAGCG -3'
(R):5'- CGTGGTAAGGAATTGAATCTCTAC -3'

Sequencing Primer
(F):5'- TCAAGAGAAATGCTAGCGATTTATC -3'
(R):5'- GACCAAAAAGATTTGTGCTGCAC -3'
Posted On2018-04-02