Incidental Mutation 'R6361:Itgb3'
ID513131
Institutional Source Beutler Lab
Gene Symbol Itgb3
Ensembl Gene ENSMUSG00000020689
Gene Nameintegrin beta 3
SynonymsCD61, platelet glycoprotein IIIa (GP3A)
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R6361 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location104608000-104670476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104665582 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 750 (K750E)
Ref Sequence ENSEMBL: ENSMUSP00000021028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021028]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021028
AA Change: K750E

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021028
Gene: ENSMUSG00000020689
AA Change: K750E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
PSI 29 75 4.43e-5 SMART
INB 37 460 3.16e-276 SMART
VWA 136 395 8.65e-2 SMART
Pfam:EGF_2 511 546 6.8e-7 PFAM
Pfam:EGF_2 553 583 8.1e-7 PFAM
Integrin_B_tail 633 717 1.07e-28 SMART
Integrin_b_cyt 741 787 1.78e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127140
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ITGB3 protein product is the integrin beta chain beta 3. Integrins are integral cell-surface proteins composed of an alpha chain and a beta chain. A given chain may combine with multiple partners resulting in different integrins. Integrin beta 3 is found along with the alpha IIb chain in platelets. Integrins are known to participate in cell adhesion as well as cell-surface mediated signalling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit platelet defects, extended bleeding times, cutaneous and gastrointestinal bleeding, anemia, increased bone mass, hypocalcemia, reduced survival, and placental defects associated with some fetal loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Itgb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Itgb3 APN 11 104633584 missense probably damaging 1.00
IGL01460:Itgb3 APN 11 104662394 nonsense probably null
IGL01615:Itgb3 APN 11 104643965 missense probably damaging 1.00
IGL01669:Itgb3 APN 11 104633390 splice site probably benign
IGL02057:Itgb3 APN 11 104632348 missense probably damaging 1.00
IGL02192:Itgb3 APN 11 104643939 missense probably benign
IGL02604:Itgb3 APN 11 104662443 missense probably damaging 0.99
IGL02708:Itgb3 APN 11 104637829 missense possibly damaging 0.60
IGL02901:Itgb3 APN 11 104637946 missense probably benign 0.18
IGL03288:Itgb3 APN 11 104633467 missense probably damaging 1.00
R0042:Itgb3 UTSW 11 104667140 missense possibly damaging 0.80
R0042:Itgb3 UTSW 11 104667140 missense possibly damaging 0.80
R0123:Itgb3 UTSW 11 104637088 missense probably damaging 1.00
R0125:Itgb3 UTSW 11 104643963 missense probably damaging 1.00
R0637:Itgb3 UTSW 11 104658876 missense probably benign 0.02
R2017:Itgb3 UTSW 11 104637962 missense possibly damaging 0.70
R2045:Itgb3 UTSW 11 104623413 missense probably benign
R2200:Itgb3 UTSW 11 104640986 splice site probably null
R2225:Itgb3 UTSW 11 104665510 missense probably benign 0.00
R2429:Itgb3 UTSW 11 104637088 missense probably damaging 1.00
R3820:Itgb3 UTSW 11 104633612 nonsense probably null
R4863:Itgb3 UTSW 11 104665520 missense probably damaging 1.00
R5116:Itgb3 UTSW 11 104641077 missense probably benign 0.20
R5301:Itgb3 UTSW 11 104633654 splice site probably null
R5933:Itgb3 UTSW 11 104637979 missense possibly damaging 0.63
R6436:Itgb3 UTSW 11 104633492 missense probably damaging 0.99
R6452:Itgb3 UTSW 11 104633464 nonsense probably null
R7196:Itgb3 UTSW 11 104633612 nonsense probably null
R7438:Itgb3 UTSW 11 104643577 missense possibly damaging 0.90
R8006:Itgb3 UTSW 11 104665496 missense possibly damaging 0.56
R8068:Itgb3 UTSW 11 104665511 missense probably benign 0.35
Z1176:Itgb3 UTSW 11 104643623 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TCATTCCTGGGAGTCTCTGG -3'
(R):5'- CTCAGTGATCAGGACATGTGGTC -3'

Sequencing Primer
(F):5'- GAGTCTCTGGTGATTCCTGCTC -3'
(R):5'- TGGGAGGCCTCATAGCACATAC -3'
Posted On2018-04-27