Incidental Mutation 'R6361:Dhrs7'
ID535637
Institutional Source Beutler Lab
Gene Symbol Dhrs7
Ensembl Gene ENSMUSG00000021094
Gene Namedehydrogenase/reductase (SDR family) member 7
SynonymsretSDR4, 2310016E22Rik, 5730564L20Rik, retDSR4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6361 (G1)
Quality Score51.0072
Status Validated
Chromosome12
Chromosomal Location72650353-72664909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 72664659 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 32 (L32V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021512] [ENSMUST00000220821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021512
AA Change: L35V

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021512
Gene: ENSMUSG00000021094
AA Change: L35V

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:KR 51 227 2.5e-11 PFAM
Pfam:adh_short 51 250 4.4e-52 PFAM
Pfam:adh_short_C2 57 267 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220821
AA Change: L35V

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably damaging
Transcript: ENSMUST00000221750
AA Change: L32V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family, which has over 46,000 members. Members in this family are enzymes that metabolize many different compounds, such as steroid hormones, prostaglandins, retinoids, lipids and xenobiotics. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Dhrs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dhrs7 APN 12 72659350 missense probably damaging 1.00
IGL00715:Dhrs7 APN 12 72652390 missense probably damaging 1.00
IGL02398:Dhrs7 APN 12 72664692 missense probably damaging 1.00
R0421:Dhrs7 UTSW 12 72653086 splice site probably benign
R0691:Dhrs7 UTSW 12 72652351 missense probably damaging 1.00
R1640:Dhrs7 UTSW 12 72652315 missense possibly damaging 0.86
R1696:Dhrs7 UTSW 12 72653120 missense possibly damaging 0.88
R1727:Dhrs7 UTSW 12 72659464 missense probably damaging 1.00
R1791:Dhrs7 UTSW 12 72653165 missense probably benign 0.13
R2046:Dhrs7 UTSW 12 72652266 missense possibly damaging 0.47
R2124:Dhrs7 UTSW 12 72653177 missense probably damaging 1.00
R2205:Dhrs7 UTSW 12 72656370 missense probably damaging 1.00
R2356:Dhrs7 UTSW 12 72652381 missense probably benign 0.00
R3431:Dhrs7 UTSW 12 72664727 missense probably damaging 0.99
R4492:Dhrs7 UTSW 12 72653125 missense probably damaging 1.00
R4744:Dhrs7 UTSW 12 72652251 missense possibly damaging 0.94
R4747:Dhrs7 UTSW 12 72653118 missense probably benign 0.03
R5050:Dhrs7 UTSW 12 72657410 missense probably damaging 1.00
R5076:Dhrs7 UTSW 12 72659481 missense probably benign 0.00
R5678:Dhrs7 UTSW 12 72657332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAAATCAGGGCCATTTTCG -3'
(R):5'- CTTCTATTGCAACACCCCGG -3'

Sequencing Primer
(F):5'- GGGCCATTTTCGAATTAAGACAAGC -3'
(R):5'- AGTCTTGCACGCAGTAGG -3'
Posted On2018-09-14