Incidental Mutation 'R6361:Crispld1'
ID513103
Institutional Source Beutler Lab
Gene Symbol Crispld1
Ensembl Gene ENSMUSG00000025776
Gene Namecysteine-rich secretory protein LCCL domain containing 1
SynonymsCocoacrisp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6361 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location17727045-17766344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17762231 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 480 (I480M)
Ref Sequence ENSEMBL: ENSMUSP00000124095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095075] [ENSMUST00000159958]
Predicted Effect probably damaging
Transcript: ENSMUST00000095075
AA Change: I480M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092686
Gene: ENSMUSG00000025776
AA Change: I480M

DomainStartEndE-ValueType
SCP 60 214 1.63e-41 SMART
LCCL 291 375 1.6e-52 SMART
LCCL 392 483 1.55e-59 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159958
AA Change: I480M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124095
Gene: ENSMUSG00000025776
AA Change: I480M

DomainStartEndE-ValueType
SCP 60 214 1.63e-41 SMART
LCCL 291 375 1.6e-52 SMART
LCCL 392 483 1.55e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189853
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Crispld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Crispld1 APN 1 17746801 missense probably benign 0.21
IGL01610:Crispld1 APN 1 17746725 splice site probably null
IGL01991:Crispld1 APN 1 17753017 missense probably benign
IGL02004:Crispld1 APN 1 17747520 missense probably damaging 1.00
IGL02178:Crispld1 APN 1 17762103 splice site probably benign
IGL02200:Crispld1 APN 1 17750333 unclassified probably benign
IGL02251:Crispld1 APN 1 17728840 missense probably benign 0.06
IGL02506:Crispld1 APN 1 17756305 missense probably damaging 0.99
IGL02883:Crispld1 APN 1 17746789 missense possibly damaging 0.87
IGL03310:Crispld1 APN 1 17745477 splice site probably benign
milliliter UTSW 1 17750801 missense possibly damaging 0.81
Spoonful UTSW 1 17762141 missense probably damaging 1.00
R0068:Crispld1 UTSW 1 17752988 missense possibly damaging 0.89
R0324:Crispld1 UTSW 1 17749591 missense probably benign
R0542:Crispld1 UTSW 1 17746768 missense possibly damaging 0.75
R1117:Crispld1 UTSW 1 17749622 missense probably benign 0.03
R1157:Crispld1 UTSW 1 17745363 missense possibly damaging 0.70
R1585:Crispld1 UTSW 1 17750800 missense possibly damaging 0.68
R1630:Crispld1 UTSW 1 17728798 missense probably benign
R2081:Crispld1 UTSW 1 17762179 missense probably damaging 0.99
R2143:Crispld1 UTSW 1 17749636 missense probably benign
R2472:Crispld1 UTSW 1 17745828 missense probably null 0.12
R2520:Crispld1 UTSW 1 17750776 missense probably damaging 1.00
R4476:Crispld1 UTSW 1 17747510 missense probably damaging 1.00
R4486:Crispld1 UTSW 1 17752878 missense probably benign 0.01
R4779:Crispld1 UTSW 1 17749607 missense probably benign
R5508:Crispld1 UTSW 1 17752983 missense probably damaging 1.00
R5568:Crispld1 UTSW 1 17750271 missense probably benign 0.01
R6155:Crispld1 UTSW 1 17753017 missense probably benign
R6252:Crispld1 UTSW 1 17749507 missense probably benign 0.00
R6617:Crispld1 UTSW 1 17728662 missense probably benign 0.02
R6760:Crispld1 UTSW 1 17750801 missense possibly damaging 0.81
R6961:Crispld1 UTSW 1 17762141 missense probably damaging 1.00
R7278:Crispld1 UTSW 1 17752878 missense probably benign 0.01
R7403:Crispld1 UTSW 1 17747596 missense probably damaging 1.00
R7592:Crispld1 UTSW 1 17728766 missense possibly damaging 0.64
R7837:Crispld1 UTSW 1 17728730 missense probably benign 0.42
Z1088:Crispld1 UTSW 1 17764076 missense probably benign
Z1176:Crispld1 UTSW 1 17728613 start gained probably benign
Z1176:Crispld1 UTSW 1 17752851 missense possibly damaging 0.60
Z1177:Crispld1 UTSW 1 17764092 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTGGCTACACTATAGAGCAGAG -3'
(R):5'- TAACCGCATCTGGTACTAGAGC -3'

Sequencing Primer
(F):5'- GCTACACTATAGAGCAGAGTCTGTC -3'
(R):5'- TAGAGCTCCTCTCATCCCAGAAGG -3'
Posted On2018-04-27