Incidental Mutation 'R6361:Usp37'
ID513105
Institutional Source Beutler Lab
Gene Symbol Usp37
Ensembl Gene ENSMUSG00000033364
Gene Nameubiquitin specific peptidase 37
SynonymsC330008N13Rik, 4932415L06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6361 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74435511-74544284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74453893 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 723 (I723T)
Ref Sequence ENSEMBL: ENSMUSP00000035445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044260] [ENSMUST00000189257]
Predicted Effect probably benign
Transcript: ENSMUST00000044260
AA Change: I723T

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000035445
Gene: ENSMUSG00000033364
AA Change: I723T

DomainStartEndE-ValueType
Pfam:UCH_N 1 105 5.1e-47 PFAM
low complexity region 182 200 N/A INTRINSIC
Pfam:UCH_1 341 645 3.4e-16 PFAM
UIM 704 723 1.33e1 SMART
UIM 806 825 1.04e-1 SMART
UIM 828 847 2.11e-2 SMART
low complexity region 893 909 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188012
Predicted Effect probably benign
Transcript: ENSMUST00000189257
AA Change: I745T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000140670
Gene: ENSMUSG00000033364
AA Change: I745T

DomainStartEndE-ValueType
PDB:3U12|B 4 125 2e-71 PDB
low complexity region 182 200 N/A INTRINSIC
Pfam:UCH_1 341 608 4.3e-19 PFAM
low complexity region 628 646 N/A INTRINSIC
UIM 704 723 1.33e1 SMART
UIM 806 825 1.04e-1 SMART
UIM 828 847 2.11e-2 SMART
low complexity region 893 909 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191058
Meta Mutation Damage Score 0.1007 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Usp37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Usp37 APN 1 74490154 missense probably benign 0.05
IGL00961:Usp37 APN 1 74490155 missense probably benign
IGL01089:Usp37 APN 1 74493046 nonsense probably null
IGL01348:Usp37 APN 1 74461702 missense probably damaging 0.98
IGL01609:Usp37 APN 1 74475040 missense probably benign 0.02
PIT4544001:Usp37 UTSW 1 74470579 missense possibly damaging 0.65
R0331:Usp37 UTSW 1 74454064 nonsense probably null
R0332:Usp37 UTSW 1 74495710 missense possibly damaging 0.47
R0418:Usp37 UTSW 1 74490107 missense probably benign 0.01
R0456:Usp37 UTSW 1 74468348 missense probably damaging 1.00
R1605:Usp37 UTSW 1 74493004 missense possibly damaging 0.59
R1756:Usp37 UTSW 1 74479655 missense probably benign 0.20
R1971:Usp37 UTSW 1 74439968 nonsense probably null
R2061:Usp37 UTSW 1 74468272 missense probably damaging 1.00
R2130:Usp37 UTSW 1 74461656 missense probably damaging 1.00
R2215:Usp37 UTSW 1 74444526 missense probably damaging 1.00
R2867:Usp37 UTSW 1 74450532 missense probably damaging 1.00
R2867:Usp37 UTSW 1 74450532 missense probably damaging 1.00
R3716:Usp37 UTSW 1 74492986 missense possibly damaging 0.93
R5077:Usp37 UTSW 1 74441561 missense probably damaging 0.99
R5635:Usp37 UTSW 1 74495811 start gained probably benign
R5826:Usp37 UTSW 1 74470626 missense probably damaging 0.99
R5933:Usp37 UTSW 1 74485982 missense probably damaging 0.98
R6048:Usp37 UTSW 1 74478136 splice site probably null
R6169:Usp37 UTSW 1 74495751 missense probably damaging 0.99
R6193:Usp37 UTSW 1 74492928 missense probably damaging 1.00
R6235:Usp37 UTSW 1 74475133 nonsense probably null
R6572:Usp37 UTSW 1 74495782 missense possibly damaging 0.95
R6759:Usp37 UTSW 1 74495749 nonsense probably null
R6997:Usp37 UTSW 1 74453959 missense probably benign 0.01
R7471:Usp37 UTSW 1 74495628 critical splice donor site probably null
R7632:Usp37 UTSW 1 74468374 missense probably benign 0.04
R7691:Usp37 UTSW 1 74486760 frame shift probably null
RF017:Usp37 UTSW 1 74470690 missense probably damaging 1.00
X0058:Usp37 UTSW 1 74453923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAAGACGCTCTGACTCCAC -3'
(R):5'- ATTGTGCAGATTAGAGCCTGGG -3'

Sequencing Primer
(F):5'- GCTCTATGACTTCCATGTCCAAATG -3'
(R):5'- CCTGGGAAGGCAGAACTG -3'
Posted On2018-04-27