Incidental Mutation 'R6482:Gm21936'
ID 517175
Institutional Source Beutler Lab
Gene Symbol Gm21936
Ensembl Gene ENSMUSG00000113201
Gene Name predicted gene, 21936
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock # R6482 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 87795512-87795946 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87795795 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 95 (Y95C)
Ref Sequence ENSEMBL: ENSMUSP00000152437 (fasta)
AlphaFold A0A1Y7VJE9
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220970
Predicted Effect probably damaging
Transcript: ENSMUST00000221442
AA Change: Y95C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,011,562 I415V probably benign Het
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Hrh1 A G 6: 114,480,763 Q335R possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Itgav T C 2: 83,794,270 S735P probably damaging Het
Klrg1 G T 6: 122,271,453 C162* probably null Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nkx2-2 T A 2: 147,185,976 I15F probably damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Olfr1104 G C 2: 87,022,525 F6L probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Pgpep1l C T 7: 68,239,067 probably null Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Plxna4 A G 6: 32,516,737 S315P probably benign Het
Psg21 A T 7: 18,654,739 probably null Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Rnf219 A T 14: 104,479,817 C373* probably null Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vmn1r20 A G 6: 57,432,108 S140G probably benign Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wapl A G 14: 34,692,692 S504G probably benign Het
Wnt5b A T 6: 119,433,612 L289Q possibly damaging Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Gm21936
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Gm21936 APN 12 87795808 missense possibly damaging 0.90
R6232:Gm21936 UTSW 12 87795581 nonsense probably null
R7833:Gm21936 UTSW 12 87795552 missense unknown
R8754:Gm21936 UTSW 12 87795799 missense possibly damaging 0.89
R9612:Gm21936 UTSW 12 87795737 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAAGAGTATGCTCAGGTGACC -3'
(R):5'- CAAGATGCCAATTGTGTTGAGC -3'

Sequencing Primer
(F):5'- TATGCTCAGGTGACCAAAATGCTG -3'
(R):5'- TCTTCAGACAACTTGGAAGGTAGC -3'
Posted On 2018-05-21