Incidental Mutation 'R6463:Uck1'
ID517663
Institutional Source Beutler Lab
Gene Symbol Uck1
Ensembl Gene ENSMUSG00000002550
Gene Nameuridine-cytidine kinase 1
SynonymsURK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6463 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32255002-32260159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32258655 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 100 (N100S)
Ref Sequence ENSEMBL: ENSMUSP00000002625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002625] [ENSMUST00000036473]
Predicted Effect probably benign
Transcript: ENSMUST00000002625
AA Change: N100S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000002625
Gene: ENSMUSG00000002550
AA Change: N100S

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:CoaE 30 198 1.1e-8 PFAM
Pfam:AAA_17 31 188 3.8e-8 PFAM
Pfam:PRK 31 225 1.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036473
SMART Domains Protein: ENSMUSP00000038722
Gene: ENSMUSG00000039254

DomainStartEndE-ValueType
Pfam:PMT 42 289 2.8e-96 PFAM
MIR 318 381 7.45e-8 SMART
MIR 392 449 1.65e-9 SMART
MIR 456 513 6.2e-5 SMART
Pfam:PMT_4TMC 542 740 3.9e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134351
Predicted Effect unknown
Transcript: ENSMUST00000138133
AA Change: N26S
SMART Domains Protein: ENSMUSP00000125350
Gene: ENSMUSG00000002550
AA Change: N26S

DomainStartEndE-ValueType
Pfam:PRK 1 151 1e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142797
Predicted Effect probably benign
Transcript: ENSMUST00000192998
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a uridine-cytidine kinase that catalyzes the phosphorylation of uridine and cytidine to uridine monophosphate (UMP) and cytidine monophosphate (CMP) but not the phosphorylation of deoxyribonucleosides or purine ribonucleosides. This enzyme can also phosphorylate uridine and cytidine analogs and uses both ATP and GTP as a phosphate donor. Alternative splicing results in multiple splice variants encoding distinct isoforms. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Uck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Uck1 APN 2 32259669 missense probably damaging 1.00
IGL01765:Uck1 APN 2 32258676 unclassified probably benign
IGL02028:Uck1 APN 2 32258137 missense probably damaging 1.00
IGL02863:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03114:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03159:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03325:Uck1 APN 2 32258322 missense probably benign 0.04
PIT4378001:Uck1 UTSW 2 32256034 missense probably damaging 1.00
R1019:Uck1 UTSW 2 32256193 missense possibly damaging 0.88
R1332:Uck1 UTSW 2 32259654 missense probably damaging 1.00
R1336:Uck1 UTSW 2 32259654 missense probably damaging 1.00
R1428:Uck1 UTSW 2 32258355 missense probably damaging 1.00
R2173:Uck1 UTSW 2 32256076 unclassified probably benign
R2233:Uck1 UTSW 2 32258303 missense probably damaging 1.00
R2234:Uck1 UTSW 2 32258303 missense probably damaging 1.00
R2938:Uck1 UTSW 2 32256076 unclassified probably benign
R3079:Uck1 UTSW 2 32258077 unclassified probably benign
R4667:Uck1 UTSW 2 32256034 missense probably damaging 1.00
R5036:Uck1 UTSW 2 32258466 unclassified probably benign
R7072:Uck1 UTSW 2 32258166 missense probably damaging 1.00
R7690:Uck1 UTSW 2 32258172 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGCCCGCTCACATTAGTAAC -3'
(R):5'- CAGTGTCAGCCAATCAGAAAGTC -3'

Sequencing Primer
(F):5'- CTCACATTAGTAACAAGGGGCCTG -3'
(R):5'- CAGCCAATCAGAAAGTCTTTGTTCC -3'
Posted On2018-05-21