Incidental Mutation 'R6434:Obp2b'
ID518674
Institutional Source Beutler Lab
Gene Symbol Obp2b
Ensembl Gene ENSMUSG00000079539
Gene Nameodorant binding protein 2B
SynonymsLcn14, OTTMUSG00000012631
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25737009-25740097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25738587 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 118 (Y118H)
Ref Sequence ENSEMBL: ENSMUSP00000109830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114192]
Predicted Effect probably damaging
Transcript: ENSMUST00000114192
AA Change: Y118H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109830
Gene: ENSMUSG00000079539
AA Change: Y118H

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:Lipocalin 31 169 5.6e-32 PFAM
Meta Mutation Damage Score 0.7260 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small extracellular protein belonging to the lipocalin superfamily. The protein is thought to transport small, hydrophobic, volatile molecules or odorants through the nasal mucus to olfactory receptors, and may also function as a scavenger of highly concentrated or toxic odors. The protein is expressed as a monomer in the nasal mucus, and can bind diverse types of odorants with a higher affinity for aldehydes and fatty acids. This gene and a highly similar family member are located in a cluster of lipocalin genes on chromosome 9. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Obp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Obp2b APN 2 25738581 missense probably damaging 1.00
IGL01293:Obp2b APN 2 25737707 missense probably benign 0.00
IGL01731:Obp2b APN 2 25739281 missense possibly damaging 0.74
IGL01751:Obp2b APN 2 25737748 missense possibly damaging 0.89
IGL02631:Obp2b APN 2 25739243 missense probably damaging 0.96
R0035:Obp2b UTSW 2 25738633 missense probably damaging 1.00
R0035:Obp2b UTSW 2 25738633 missense probably damaging 1.00
R1753:Obp2b UTSW 2 25738640 critical splice donor site probably null
R1955:Obp2b UTSW 2 25738551 missense probably benign 0.12
R4956:Obp2b UTSW 2 25737075 missense probably damaging 0.96
R5253:Obp2b UTSW 2 25737143 missense probably benign 0.08
R7176:Obp2b UTSW 2 25737748 missense possibly damaging 0.89
Z1177:Obp2b UTSW 2 25737683 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TAATTATGGAGATCACTGGGCTGG -3'
(R):5'- TAGGTACCCTCCCAGATGACAC -3'

Sequencing Primer
(F):5'- TGGACAGCCTGGCTCTC -3'
(R):5'- CTCCCAGATGACACTTTCAATTTAG -3'
Posted On2018-05-24