Incidental Mutation 'R6434:Ccdc81'
ID518698
Institutional Source Beutler Lab
Gene Symbol Ccdc81
Ensembl Gene ENSMUSG00000039391
Gene Namecoiled-coil domain containing 81
Synonyms4921513D09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location89866148-89903629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89876144 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 474 (Y474C)
Ref Sequence ENSEMBL: ENSMUSP00000044087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041195] [ENSMUST00000131966]
Predicted Effect probably damaging
Transcript: ENSMUST00000041195
AA Change: Y474C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044087
Gene: ENSMUSG00000039391
AA Change: Y474C

DomainStartEndE-ValueType
Pfam:DUF4496 29 165 2.7e-47 PFAM
low complexity region 224 233 N/A INTRINSIC
low complexity region 344 355 N/A INTRINSIC
coiled coil region 434 468 N/A INTRINSIC
low complexity region 623 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131966
SMART Domains Protein: ENSMUSP00000117788
Gene: ENSMUSG00000039391

DomainStartEndE-ValueType
Pfam:DUF4496 28 165 2e-41 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Ccdc81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ccdc81 APN 7 89869615 splice site probably benign
IGL01948:Ccdc81 APN 7 89875855 missense possibly damaging 0.80
IGL02177:Ccdc81 APN 7 89875780 missense possibly damaging 0.94
IGL02396:Ccdc81 APN 7 89881649 missense probably benign
IGL02420:Ccdc81 APN 7 89875738 missense probably benign 0.16
IGL02536:Ccdc81 APN 7 89877580 splice site probably benign
IGL03195:Ccdc81 APN 7 89896708 missense probably benign 0.05
IGL03397:Ccdc81 APN 7 89896828 missense probably damaging 1.00
I0000:Ccdc81 UTSW 7 89898051 missense probably damaging 1.00
R0089:Ccdc81 UTSW 7 89893116 missense possibly damaging 0.87
R0409:Ccdc81 UTSW 7 89886215 missense probably benign 0.01
R0449:Ccdc81 UTSW 7 89890471 missense probably damaging 1.00
R0490:Ccdc81 UTSW 7 89887762 missense probably benign 0.28
R0511:Ccdc81 UTSW 7 89893296 missense probably damaging 1.00
R0562:Ccdc81 UTSW 7 89903229 missense probably benign 0.02
R0801:Ccdc81 UTSW 7 89887658 intron probably null
R0944:Ccdc81 UTSW 7 89866569 missense probably damaging 0.99
R1006:Ccdc81 UTSW 7 89866561 missense probably benign 0.03
R1334:Ccdc81 UTSW 7 89866561 missense probably benign 0.03
R1526:Ccdc81 UTSW 7 89875873 missense probably damaging 0.99
R1623:Ccdc81 UTSW 7 89886182 missense probably benign 0.00
R1753:Ccdc81 UTSW 7 89866561 missense probably benign 0.03
R1885:Ccdc81 UTSW 7 89866611 missense possibly damaging 0.80
R1886:Ccdc81 UTSW 7 89866611 missense possibly damaging 0.80
R1887:Ccdc81 UTSW 7 89866611 missense possibly damaging 0.80
R1889:Ccdc81 UTSW 7 89882294 nonsense probably null
R1964:Ccdc81 UTSW 7 89886153 missense probably benign
R1997:Ccdc81 UTSW 7 89898063 missense probably damaging 1.00
R3725:Ccdc81 UTSW 7 89866630 missense possibly damaging 0.95
R5494:Ccdc81 UTSW 7 89877573 missense probably damaging 1.00
R5660:Ccdc81 UTSW 7 89893129 missense probably benign
R6275:Ccdc81 UTSW 7 89882311 missense possibly damaging 0.59
R6711:Ccdc81 UTSW 7 89887798 missense probably damaging 0.98
R7287:Ccdc81 UTSW 7 89893123 missense probably damaging 0.98
R7582:Ccdc81 UTSW 7 89876145 missense probably damaging 0.99
R8002:Ccdc81 UTSW 7 89876135 missense probably benign
R8309:Ccdc81 UTSW 7 89877578 critical splice acceptor site probably null
RF018:Ccdc81 UTSW 7 89866698 intron probably null
X0061:Ccdc81 UTSW 7 89877489 missense probably benign 0.00
Z1177:Ccdc81 UTSW 7 89881657 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGAACAGGGCCTCAGAACC -3'
(R):5'- TGAAGACACAGTGTGCTTGAG -3'

Sequencing Primer
(F):5'- CTACCAAACATATGGCATGCATG -3'
(R):5'- TTAGAGCCCTCAGAATGAAAGAC -3'
Posted On2018-05-24