Incidental Mutation 'R7343:Epha6'
ID 570055
Institutional Source Beutler Lab
Gene Symbol Epha6
Ensembl Gene ENSMUSG00000055540
Gene Name Eph receptor A6
Synonyms m-ehk2, Hek12, Ehk2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7343 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 59653483-60605531 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 59960430 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 636 (A636E)
Ref Sequence ENSEMBL: ENSMUSP00000066734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068860]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068860
AA Change: A636E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: A636E

DomainStartEndE-ValueType
low complexity region 4 37 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
EPH_lbd 128 301 5.95e-125 SMART
Pfam:GCC2_GCC3 361 406 1.6e-8 PFAM
FN3 426 518 5.83e-3 SMART
FN3 537 618 2.19e-7 SMART
Pfam:EphA2_TM 644 722 1.8e-22 PFAM
TyrKc 725 1024 3.66e-122 SMART
SAM 1052 1119 1.24e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A C 6: 83,162,371 N426T probably benign Het
6430548M08Rik A G 8: 120,145,588 D85G probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Abcg3 A T 5: 104,968,234 F245I probably benign Het
Abhd17a G T 10: 80,584,157 F231L possibly damaging Het
Adgra1 A T 7: 139,876,142 D562V probably damaging Het
Akap7 C A 10: 25,289,669 probably benign Het
Akap9 A G 5: 4,046,364 D2413G probably damaging Het
Akr1c18 A T 13: 4,137,237 C193S probably damaging Het
Aloxe3 A T 11: 69,132,743 M231L probably benign Het
Apoh A G 11: 108,395,848 T33A probably benign Het
Atp13a5 T C 16: 29,321,749 N330D probably benign Het
C1ql3 T G 2: 13,010,778 M24L probably benign Het
Cacna1d T C 14: 30,123,057 N712S probably benign Het
Cbs T C 17: 31,619,139 M379V possibly damaging Het
Ccdc167 T C 17: 29,705,543 D28G probably damaging Het
Ccp110 A T 7: 118,724,575 Q679L probably benign Het
Ccz1 A T 5: 143,998,182 L310H probably damaging Het
Cerkl A T 2: 79,428,760 D44E probably damaging Het
Cfap221 T A 1: 119,995,098 E38V possibly damaging Het
Chia1 T A 3: 106,132,015 *474R probably null Het
Clint1 C T 11: 45,883,763 T32M probably damaging Het
Clk3 A T 9: 57,760,956 F227L probably damaging Het
Col5a3 C T 9: 20,793,946 probably null Het
Cul2 T C 18: 3,426,873 I501T probably benign Het
Dag1 G A 9: 108,209,093 A283V possibly damaging Het
Ddr2 A T 1: 169,982,078 W777R probably damaging Het
Deaf1 A T 7: 141,322,958 V151D probably damaging Het
Dido1 A T 2: 180,675,121 V631E possibly damaging Het
Dpp4 G A 2: 62,358,901 Q429* probably null Het
Dscaml1 A G 9: 45,752,916 R2030G probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
E2f8 T A 7: 48,867,965 M697L probably damaging Het
Eef2kmt C A 16: 5,247,435 G303W probably damaging Het
Eif2ak1 A G 5: 143,877,671 Y182C probably damaging Het
Fancd2 G A 6: 113,536,939 V95I probably benign Het
Fbln5 A T 12: 101,760,816 C292S probably damaging Het
Fgfr4 A G 13: 55,159,155 Y219C probably damaging Het
Frem1 T G 4: 82,994,122 K670T probably damaging Het
Fsip2 A T 2: 82,979,367 H2010L probably benign Het
Gas2l2 A T 11: 83,421,990 L832* probably null Het
Gbe1 A G 16: 70,361,015 T101A probably benign Het
Gm5114 T A 7: 39,408,756 I480F probably damaging Het
Gm7145 A T 1: 117,986,112 R241S probably damaging Het
Gnal G A 18: 67,135,525 V161I probably benign Het
Gtpbp1 T C 15: 79,691,042 C46R probably benign Het
Gucy2c A T 6: 136,702,748 L971Q probably damaging Het
Hsp90b1 T C 10: 86,692,183 E740G probably damaging Het
Lingo2 G A 4: 35,709,450 L177F possibly damaging Het
Mfsd6l A G 11: 68,557,048 T242A possibly damaging Het
Mmadhc C T 2: 50,291,445 R71K probably damaging Het
Mrm3 G T 11: 76,249,900 V245L probably damaging Het
Nav3 T A 10: 109,903,758 I117F probably damaging Het
Noc3l A T 19: 38,795,024 V636D probably damaging Het
Nwd1 A T 8: 72,711,782 Q1486L probably damaging Het
Olfr1205 T G 2: 88,831,846 I243R probably damaging Het
Olfr1380 A G 11: 49,564,502 T194A possibly damaging Het
Olfr139 G T 11: 74,044,900 R125S possibly damaging Het
Olfr433 A T 1: 174,042,853 K301M probably damaging Het
Olfr785 C G 10: 129,409,983 L206V possibly damaging Het
Pax9 T A 12: 56,695,862 M1K probably null Het
Pcdha1 T C 18: 36,930,649 V122A probably damaging Het
Pgpep1l A T 7: 68,237,721 S44T probably damaging Het
Pla2g3 C T 11: 3,493,022 L452F possibly damaging Het
Plbd2 G A 5: 120,493,149 R188W probably damaging Het
Ppp1r42 G A 1: 9,968,857 P346L probably benign Het
Prdm8 T A 5: 98,184,516 V92D probably damaging Het
Ripor2 C A 13: 24,701,444 S554* probably null Het
Rps19 T C 7: 24,885,146 V4A probably damaging Het
Rrm2b T A 15: 37,944,573 I159F probably benign Het
Rusc1 C A 3: 89,091,750 G242W probably damaging Het
Sarm1 A G 11: 78,497,257 S68P possibly damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Slc22a4 A G 11: 53,986,538 F509S possibly damaging Het
Slc39a12 G A 2: 14,452,000 A600T probably damaging Het
Spta1 A T 1: 174,223,349 H1798L probably damaging Het
Sulf2 T G 2: 166,077,616 D804A possibly damaging Het
Suz12 A T 11: 80,019,703 E316D probably benign Het
Tbrg4 A G 11: 6,620,065 S270P probably benign Het
Tecta T C 9: 42,337,332 T1925A probably damaging Het
Thrap3 A T 4: 126,178,430 F390I probably damaging Het
Tpr C A 1: 150,393,494 A70E unknown Het
Trpv4 G C 5: 114,636,459 P188R probably benign Het
Txlna A C 4: 129,632,160 L298R probably damaging Het
Ubr4 T C 4: 139,413,438 S1223P probably benign Het
Ucp1 A T 8: 83,295,252 T238S probably damaging Het
Ush2a A G 1: 188,415,746 S957G probably benign Het
Usp34 A G 11: 23,488,868 N3496D Het
Vmn2r50 T C 7: 10,050,350 probably null Het
Wdr54 A G 6: 83,154,939 V130A probably benign Het
Zfp692 A T 11: 58,311,505 E362V probably damaging Het
Zfp811 A G 17: 32,797,513 Y518H probably damaging Het
Zfp994 A C 17: 22,200,068 C633W probably benign Het
Other mutations in Epha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Epha6 APN 16 59915962 missense probably damaging 1.00
IGL00849:Epha6 APN 16 60425111 missense possibly damaging 0.89
IGL00898:Epha6 APN 16 59775541 critical splice donor site probably null
IGL01353:Epha6 APN 16 60424895 missense probably damaging 1.00
IGL01409:Epha6 APN 16 59655737 nonsense probably null
IGL01577:Epha6 APN 16 59956926 missense possibly damaging 0.57
IGL01653:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01654:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01655:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01657:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01663:Epha6 APN 16 59775644 missense probably damaging 1.00
IGL01899:Epha6 APN 16 59839303 missense probably benign 0.05
IGL02272:Epha6 APN 16 59818937 missense probably damaging 1.00
IGL03265:Epha6 APN 16 60060231 splice site probably benign
IGL03333:Epha6 APN 16 59682688 missense probably damaging 1.00
rauwulfia UTSW 16 59682616 missense probably damaging 1.00
PIT4377001:Epha6 UTSW 16 60205552 missense probably damaging 0.98
R0505:Epha6 UTSW 16 60205732 missense possibly damaging 0.89
R1593:Epha6 UTSW 16 60424904 missense probably damaging 1.00
R1764:Epha6 UTSW 16 59775728 missense probably null 1.00
R1836:Epha6 UTSW 16 60205745 missense probably damaging 1.00
R2061:Epha6 UTSW 16 59655797 missense probably damaging 1.00
R2125:Epha6 UTSW 16 59682688 missense probably damaging 1.00
R2867:Epha6 UTSW 16 59960296 splice site probably null
R2867:Epha6 UTSW 16 59960296 splice site probably null
R3760:Epha6 UTSW 16 60220984 missense possibly damaging 0.70
R4305:Epha6 UTSW 16 60526520 splice site probably null
R4613:Epha6 UTSW 16 59666597 missense possibly damaging 0.80
R4818:Epha6 UTSW 16 59654063 missense probably damaging 0.99
R4832:Epha6 UTSW 16 59960413 missense probably damaging 0.98
R4895:Epha6 UTSW 16 59666555 missense probably benign 0.08
R5014:Epha6 UTSW 16 59666579 missense probably benign 0.00
R5316:Epha6 UTSW 16 59954720 missense probably damaging 0.99
R5403:Epha6 UTSW 16 59775570 missense probably damaging 1.00
R5417:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5418:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5678:Epha6 UTSW 16 59818979 missense probably damaging 1.00
R5775:Epha6 UTSW 16 59818994 missense possibly damaging 0.92
R5808:Epha6 UTSW 16 59682742 missense probably damaging 1.00
R6076:Epha6 UTSW 16 60205710 missense probably damaging 1.00
R6146:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6212:Epha6 UTSW 16 60425356 missense possibly damaging 0.77
R6242:Epha6 UTSW 16 59682662 missense probably damaging 1.00
R6503:Epha6 UTSW 16 60205621 missense possibly damaging 0.61
R6580:Epha6 UTSW 16 59682616 missense probably damaging 1.00
R6726:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6728:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6798:Epha6 UTSW 16 60605064 missense possibly damaging 0.53
R6798:Epha6 UTSW 16 60605065 missense possibly damaging 0.53
R6903:Epha6 UTSW 16 60526462 missense probably benign 0.00
R6999:Epha6 UTSW 16 60425170 missense possibly damaging 0.94
R7058:Epha6 UTSW 16 59682650 missense probably damaging 1.00
R7109:Epha6 UTSW 16 59682668 missense probably damaging 1.00
R7263:Epha6 UTSW 16 59775665 missense probably damaging 1.00
R7296:Epha6 UTSW 16 59915838 missense probably benign 0.00
R7443:Epha6 UTSW 16 59775625 missense possibly damaging 0.93
R7533:Epha6 UTSW 16 60205562 missense probably damaging 1.00
R7602:Epha6 UTSW 16 59775568 missense probably damaging 1.00
R7604:Epha6 UTSW 16 60205772 missense possibly damaging 0.89
R8321:Epha6 UTSW 16 59915954 missense probably damaging 1.00
R8414:Epha6 UTSW 16 60005667 missense probably damaging 1.00
R8794:Epha6 UTSW 16 60205672 missense probably benign 0.00
R8926:Epha6 UTSW 16 59839299 missense probably benign 0.11
R9166:Epha6 UTSW 16 60604875 missense probably benign 0.00
R9265:Epha6 UTSW 16 59655754 missense probably damaging 1.00
R9322:Epha6 UTSW 16 60424755 missense probably damaging 1.00
Z1188:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Z1189:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGGTAGCTGCTACTCC -3'
(R):5'- ATGGTGACCTTAGTTCTGCAAAC -3'

Sequencing Primer
(F):5'- TGTCAAGCATGCTGCCAC -3'
(R):5'- GGTGACCTTAGTTCTGCAAACATTAC -3'
Posted On 2019-09-13