Mutagenetix > Incidental Mutations

Incidental Mutation 'R7602:Epha6'

588089

Institutional Source

Beutler Lab

Gene Symbol

Epha6

Ensembl Gene

ENSMUSG00000055540

Gene Name

Eph receptor A6

Synonyms

m-ehk2, Hek12, Ehk2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7602 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59653483-60605531 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59775568 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 920 (D920G)

Ref Sequence

ENSEMBL: ENSMUSP00000066734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068860]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000068860
AA Change: D920G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: D920G

Domain	Start	End	E-Value	Type
low complexity region	4	37	N/A	INTRINSIC
low complexity region	79	90	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
EPH_lbd	128	301	5.95e-125	SMART
Pfam:GCC2_GCC3	361	406	1.6e-8	PFAM
FN3	426	518	5.83e-3	SMART
FN3	537	618	2.19e-7	SMART
Pfam:EphA2_TM	644	722	1.8e-22	PFAM
TyrKc	725	1024	3.66e-122	SMART
SAM	1052	1119	1.24e-22	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (58/58)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,200,178	M114V	probably benign	Het
1700025G04Rik	A	T	1: 151,980,515	Y34N	probably damaging	Het
5730559C18Rik	G	T	1: 136,225,397	C252*	probably null	Het
A2m	T	C	6: 121,642,007	V237A	probably damaging	Het
A2m	A	T	6: 121,670,936	D1129V	possibly damaging	Het
Abca7	A	G	10: 79,998,012		probably null	Het
Ap3m2	T	C	8: 22,792,754	N256S	probably benign	Het
Atr	C	T	9: 95,907,383	H1531Y	possibly damaging	Het
Carmil3	C	T	14: 55,501,508	A873V	probably null	Het
Casp8	A	C	1: 58,833,739	K258T	probably benign	Het
Cast	A	G	13: 74,736,965	S222P	probably benign	Het
Cpsf7	C	T	19: 10,535,373	P274S	probably damaging	Het
Ddx24	A	T	12: 103,416,260	L688*	probably null	Het
Ddx59	A	G	1: 136,433,821	I475V	probably benign	Het
Dhx29	T	A	13: 112,944,559	S376T	possibly damaging	Het
Dhx57	G	T	17: 80,274,861	N438K	probably benign	Het
Dlk1	T	A	12: 109,455,625		probably null	Het
Exo5	A	T	4: 120,921,621	V349E	probably benign	Het
Fam234b	T	C	6: 135,225,243	V321A	possibly damaging	Het
Gbp3	A	G	3: 142,569,061	E383G	probably benign	Het
Gga2	T	C	7: 121,997,330	N408S	probably benign	Het
Gm5346	C	T	8: 43,626,666	G174R	probably damaging	Het
Gm8298	T	C	3: 59,877,276	I390T	probably benign	Het
Gse1	T	C	8: 120,569,304	V532A	unknown	Het
Hnrnpul2	T	C	19: 8,831,309	Y712H	probably damaging	Het
Hpca	T	C	4: 129,120,226		probably benign	Het
Ifitm3	A	G	7: 141,010,459	F63L	probably damaging	Het
Kank1	A	T	19: 25,422,161	T940S	probably benign	Het
Klhl9	C	A	4: 88,722,409		probably benign	Het
Krt36	T	C	11: 100,102,960	M351V	probably benign	Het
Mthfd2	T	C	6: 83,311,848	N125D	probably benign	Het
Muc4	C	G	16: 32,753,930	Q1269E	probably benign	Het
Ncoa2	A	G	1: 13,177,126	S358P	possibly damaging	Het
Nmnat1	T	C	4: 149,473,351	H78R	probably benign	Het
Olfr1026	A	T	2: 85,923,802	Y178F	probably damaging	Het
Olfr173	T	C	16: 58,796,980	I289V	possibly damaging	Het
Olfr823	A	G	10: 130,112,310	M160T	probably benign	Het
Olfr982	T	G	9: 40,075,159	L288R	probably damaging	Het
Pabpc4	A	T	4: 123,292,892	D302V	possibly damaging	Het
Pgap1	A	T	1: 54,543,186	S167R	probably damaging	Het
Phf12	T	C	11: 78,023,283	L517P	probably benign	Het
Rcan2	A	G	17: 44,017,798	D86G	probably benign	Het
Ryk	T	C	9: 102,898,516	Y442H	probably damaging	Het
Scfd2	G	T	5: 74,462,610	Q421K	probably benign	Het
Sirpa	G	T	2: 129,609,152	V111F	probably damaging	Het
Skint4	A	T	4: 112,118,271	T143S	possibly damaging	Het
Slc12a8	C	A	16: 33,625,124	H463N	probably benign	Het
Sp110	G	A	1: 85,579,092	R417C	probably benign	Het
Sptlc2	A	G	12: 87,341,689	Y340H	probably damaging	Het
Ssc5d	T	A	7: 4,942,746	W926R	possibly damaging	Het
Tgfa	A	G	6: 86,269,962	E82G	probably damaging	Het
Thrsp	A	G	7: 97,417,307	I66T	probably damaging	Het
Ttn	T	C	2: 76,851,644	E1003G	unknown	Het
Tube1	A	T	10: 39,142,266	H113L	probably benign	Het
Uri1	A	G	7: 37,981,628	V117A	probably benign	Het
Ush2a	G	A	1: 188,648,409	C2305Y	probably damaging	Het
Zbtb7a	T	G	10: 81,144,176	V68G	probably damaging	Het
Zfr	T	A	15: 12,159,677	D686E	possibly damaging	Het
Zscan4f	G	A	7: 11,401,381	S238N	possibly damaging	Het

Other mutations in Epha6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Epha6	APN	16	59915962	missense	probably damaging	1.00
IGL00849:Epha6	APN	16	60425111	missense	possibly damaging	0.89
IGL00898:Epha6	APN	16	59775541	critical splice donor site	probably null
IGL01353:Epha6	APN	16	60424895	missense	probably damaging	1.00
IGL01409:Epha6	APN	16	59655737	nonsense	probably null
IGL01577:Epha6	APN	16	59956926	missense	possibly damaging	0.57
IGL01653:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01654:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01655:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01657:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01663:Epha6	APN	16	59775644	missense	probably damaging	1.00
IGL01899:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL02272:Epha6	APN	16	59818937	missense	probably damaging	1.00
IGL03265:Epha6	APN	16	60060231	splice site	probably benign
IGL03333:Epha6	APN	16	59682688	missense	probably damaging	1.00
rauwulfia	UTSW	16	59682616	missense	probably damaging	1.00
PIT4377001:Epha6	UTSW	16	60205552	missense	probably damaging	0.98
R0505:Epha6	UTSW	16	60205732	missense	possibly damaging	0.89
R1593:Epha6	UTSW	16	60424904	missense	probably damaging	1.00
R1764:Epha6	UTSW	16	59775728	missense	probably null	1.00
R1836:Epha6	UTSW	16	60205745	missense	probably damaging	1.00
R2061:Epha6	UTSW	16	59655797	missense	probably damaging	1.00
R2125:Epha6	UTSW	16	59682688	missense	probably damaging	1.00
R2867:Epha6	UTSW	16	59960296	splice site	probably null
R2867:Epha6	UTSW	16	59960296	splice site	probably null
R3760:Epha6	UTSW	16	60220984	missense	possibly damaging	0.70
R4305:Epha6	UTSW	16	60526520	splice site	probably null
R4613:Epha6	UTSW	16	59666597	missense	possibly damaging	0.80
R4818:Epha6	UTSW	16	59654063	missense	probably damaging	0.99
R4832:Epha6	UTSW	16	59960413	missense	probably damaging	0.98
R4895:Epha6	UTSW	16	59666555	missense	probably benign	0.08
R5014:Epha6	UTSW	16	59666579	missense	probably benign	0.00
R5316:Epha6	UTSW	16	59954720	missense	probably damaging	0.99
R5403:Epha6	UTSW	16	59775570	missense	probably damaging	1.00
R5417:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5418:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5678:Epha6	UTSW	16	59818979	missense	probably damaging	1.00
R5775:Epha6	UTSW	16	59818994	missense	possibly damaging	0.92
R5808:Epha6	UTSW	16	59682742	missense	probably damaging	1.00
R6076:Epha6	UTSW	16	60205710	missense	probably damaging	1.00
R6146:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6212:Epha6	UTSW	16	60425356	missense	possibly damaging	0.77
R6242:Epha6	UTSW	16	59682662	missense	probably damaging	1.00
R6503:Epha6	UTSW	16	60205621	missense	possibly damaging	0.61
R6580:Epha6	UTSW	16	59682616	missense	probably damaging	1.00
R6726:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6728:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6798:Epha6	UTSW	16	60605064	missense	possibly damaging	0.53
R6798:Epha6	UTSW	16	60605065	missense	possibly damaging	0.53
R6903:Epha6	UTSW	16	60526462	missense	probably benign	0.00
R6999:Epha6	UTSW	16	60425170	missense	possibly damaging	0.94
R7058:Epha6	UTSW	16	59682650	missense	probably damaging	1.00
R7109:Epha6	UTSW	16	59682668	missense	probably damaging	1.00
R7263:Epha6	UTSW	16	59775665	missense	probably damaging	1.00
R7296:Epha6	UTSW	16	59915838	missense	probably benign	0.00
R7343:Epha6	UTSW	16	59960430	missense	probably damaging	0.98
R7443:Epha6	UTSW	16	59775625	missense	possibly damaging	0.93
R7533:Epha6	UTSW	16	60205562	missense	probably damaging	1.00
R7604:Epha6	UTSW	16	60205772	missense	possibly damaging	0.89
R8321:Epha6	UTSW	16	59915954	missense	probably damaging	1.00
R8414:Epha6	UTSW	16	60005667	missense	probably damaging	1.00
R8794:Epha6	UTSW	16	60205672	missense	probably benign	0.00
R8926:Epha6	UTSW	16	59839299	missense	probably benign	0.11
R9166:Epha6	UTSW	16	60604875	missense	probably benign	0.00
R9265:Epha6	UTSW	16	59655754	missense	probably damaging	1.00
R9322:Epha6	UTSW	16	60424755	missense	probably damaging	1.00
Z1188:Epha6	UTSW	16	59654090	missense	probably damaging	1.00
Z1189:Epha6	UTSW	16	59654090	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCAACAACGACCCTTGGAG -3'
(R):5'- AGGCAGCTAATAGGTGTGATTCTC -3'

Sequencing Primer
(F):5'- GACCCTTGGAGCCTTCAAATATAG -3'
(R):5'- GATTCTCTCACAGAAGCATGATGGC -3'

Posted On

2019-10-24