Mutagenetix > Incidental Mutations

Incidental Mutation 'R5775:Epha6'

448755

Institutional Source

Beutler Lab

Gene Symbol

Epha6

Ensembl Gene

ENSMUSG00000055540

Gene Name

Eph receptor A6

Synonyms

m-ehk2, Hek12, Ehk2

MMRRC Submission

043374-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5775 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59653483-60605531 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 59818994 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 839 (R839Q)

Ref Sequence

ENSEMBL: ENSMUSP00000066734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068860] [ENSMUST00000161358]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068860
AA Change: R839Q

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: R839Q

Domain	Start	End	E-Value	Type
low complexity region	4	37	N/A	INTRINSIC
low complexity region	79	90	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
EPH_lbd	128	301	5.95e-125	SMART
Pfam:GCC2_GCC3	361	406	1.6e-8	PFAM
FN3	426	518	5.83e-3	SMART
FN3	537	618	2.19e-7	SMART
Pfam:EphA2_TM	644	722	1.8e-22	PFAM
TyrKc	725	1024	3.66e-122	SMART
SAM	1052	1119	1.24e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161358

SMART Domains

Protein: ENSMUSP00000124340
Gene: ENSMUSG00000055540

Domain	Start	End	E-Value	Type
Pfam:EphA2_TM	9	88	1.2e-26	PFAM
Pfam:Pkinase_Tyr	91	183	3e-18	PFAM
Pfam:Pkinase	91	296	1.5e-29	PFAM
Pfam:Pkinase_Tyr	179	295	6e-31	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (59/61)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6a	A	G	12: 113,546,266	D753G	possibly damaging	Het
AF067061	T	A	13: 120,263,939	C46*	probably null	Het
Arpc2	T	A	1: 74,255,949		probably null	Het
Atxn2	C	T	5: 121,813,449	T619M	probably damaging	Het
Cacna1s	T	C	1: 136,108,122	Y1120H	probably damaging	Het
Calm5	T	C	13: 3,854,435	L20S	probably damaging	Het
Carmil1	T	C	13: 24,276,537	I20V	probably benign	Het
Cd177	T	C	7: 24,752,268	E441G	probably damaging	Het
Cd63	T	A	10: 128,910,430	C9S	probably damaging	Het
Cep250	A	C	2: 155,969,374	D380A	possibly damaging	Het
Col5a3	G	T	9: 20,801,072	P509Q	unknown	Het
Cyp11b2	A	G	15: 74,853,478	V264A	probably benign	Het
Dennd6a	T	A	14: 26,619,373	L214*	probably null	Het
Dna2	A	G	10: 62,949,242	N46S	possibly damaging	Het
Elovl1	G	A	4: 118,430,897	V77I	probably benign	Het
Eml1	A	T	12: 108,506,554	Y207F	probably damaging	Het
Erlec1	A	T	11: 30,943,848	S105T	probably benign	Het
Esp3	T	A	17: 40,633,577	S37T	possibly damaging	Het
Foxh1	G	A	15: 76,669,849	A8V	probably benign	Het
Fut1	A	C	7: 45,619,462	D280A	probably damaging	Het
Gm13998	G	T	2: 119,878,411		noncoding transcript	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
H2afz	T	C	3: 137,865,619	Y61H	probably damaging	Het
Kcns1	T	C	2: 164,164,766	I426V	probably damaging	Het
Kdm4c	T	G	4: 74,359,431	V774G	probably damaging	Het
Mrc2	G	A	11: 105,337,813	V673I	probably benign	Het
Mtnr1b	G	A	9: 15,862,872	A297V	possibly damaging	Het
Olfr1173	A	T	2: 88,274,701	M116K	probably damaging	Het
Olfr889	A	T	9: 38,116,127	E110D	probably damaging	Het
Osbpl5	A	T	7: 143,704,529	V346D	probably benign	Het
Pdzrn4	A	T	15: 92,757,681	E485V	probably damaging	Het
Pgpep1	G	A	8: 70,652,451	T53M	probably damaging	Het
Pigo	T	C	4: 43,023,475	D233G	probably damaging	Het
Pmm1	A	T	15: 81,951,955	I152N	probably benign	Het
Pot1a	A	T	6: 25,757,298		probably null	Het
Ppp1r12b	G	T	1: 134,876,042	L460I	probably benign	Het
Prrc2a	T	C	17: 35,158,487	D565G	unknown	Het
Psd	C	A	19: 46,314,772	E724*	probably null	Het
Rasa2	C	T	9: 96,577,468		probably null	Het
Rsbn1	A	T	3: 103,962,572	Q783L	possibly damaging	Het
Ryr2	T	C	13: 11,769,962	Y1035C	probably damaging	Het
Sec24d	C	T	3: 123,290,460	A96V	probably benign	Het
Sec61a2	A	T	2: 5,882,774		probably null	Het
Sec62	A	G	3: 30,793,287		probably benign	Het
Tmem132b	T	A	5: 125,638,330		probably null	Het
Tnip3	A	G	6: 65,614,757	S247G	probably benign	Het
Traf3	A	G	12: 111,252,728	K263R	possibly damaging	Het
Tubgcp3	A	T	8: 12,625,056	I713N	probably damaging	Het
Unc5c	A	G	3: 141,828,520	E860G	probably damaging	Het
Usp44	A	G	10: 93,845,978	S97G	possibly damaging	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Vps37a	A	G	8: 40,529,119	H109R	probably damaging	Het
Wfikkn2	G	T	11: 94,238,288	D342E	probably benign	Het
Zfp354b	A	T	11: 50,922,820	F426Y	probably benign	Het
Zfp462	C	A	4: 55,010,590	T852N	probably damaging	Het
Zfp987	T	G	4: 146,124,935	S312R	probably benign	Het

Other mutations in Epha6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Epha6	APN	16	59915962	missense	probably damaging	1.00
IGL00849:Epha6	APN	16	60425111	missense	possibly damaging	0.89
IGL00898:Epha6	APN	16	59775541	critical splice donor site	probably null
IGL01353:Epha6	APN	16	60424895	missense	probably damaging	1.00
IGL01409:Epha6	APN	16	59655737	nonsense	probably null
IGL01577:Epha6	APN	16	59956926	missense	possibly damaging	0.57
IGL01653:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01654:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01655:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01657:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01663:Epha6	APN	16	59775644	missense	probably damaging	1.00
IGL01899:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL02272:Epha6	APN	16	59818937	missense	probably damaging	1.00
IGL03265:Epha6	APN	16	60060231	splice site	probably benign
IGL03333:Epha6	APN	16	59682688	missense	probably damaging	1.00
rauwulfia	UTSW	16	59682616	missense	probably damaging	1.00
PIT4377001:Epha6	UTSW	16	60205552	missense	probably damaging	0.98
R0505:Epha6	UTSW	16	60205732	missense	possibly damaging	0.89
R1593:Epha6	UTSW	16	60424904	missense	probably damaging	1.00
R1764:Epha6	UTSW	16	59775728	missense	probably null	1.00
R1836:Epha6	UTSW	16	60205745	missense	probably damaging	1.00
R2061:Epha6	UTSW	16	59655797	missense	probably damaging	1.00
R2125:Epha6	UTSW	16	59682688	missense	probably damaging	1.00
R2867:Epha6	UTSW	16	59960296	intron	probably null
R2867:Epha6	UTSW	16	59960296	intron	probably null
R3760:Epha6	UTSW	16	60220984	missense	possibly damaging	0.70
R4305:Epha6	UTSW	16	60526520	splice site	probably null
R4613:Epha6	UTSW	16	59666597	missense	possibly damaging	0.80
R4818:Epha6	UTSW	16	59654063	missense	probably damaging	0.99
R4832:Epha6	UTSW	16	59960413	missense	probably damaging	0.98
R4895:Epha6	UTSW	16	59666555	missense	probably benign	0.08
R5014:Epha6	UTSW	16	59666579	missense	probably benign	0.00
R5316:Epha6	UTSW	16	59954720	missense	probably damaging	0.99
R5403:Epha6	UTSW	16	59775570	missense	probably damaging	1.00
R5417:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5418:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5678:Epha6	UTSW	16	59818979	missense	probably damaging	1.00
R5808:Epha6	UTSW	16	59682742	missense	probably damaging	1.00
R6076:Epha6	UTSW	16	60205710	missense	probably damaging	1.00
R6146:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6212:Epha6	UTSW	16	60425356	missense	possibly damaging	0.77
R6242:Epha6	UTSW	16	59682662	missense	probably damaging	1.00
R6503:Epha6	UTSW	16	60205621	missense	possibly damaging	0.61
R6580:Epha6	UTSW	16	59682616	missense	probably damaging	1.00
R6726:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6728:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6798:Epha6	UTSW	16	60605064	missense	possibly damaging	0.53
R6798:Epha6	UTSW	16	60605065	missense	possibly damaging	0.53
R6903:Epha6	UTSW	16	60526462	missense	probably benign	0.00
R6999:Epha6	UTSW	16	60425170	missense	possibly damaging	0.94
R7058:Epha6	UTSW	16	59682650	missense	probably damaging	1.00
R7109:Epha6	UTSW	16	59682668	missense	probably damaging	1.00
R7263:Epha6	UTSW	16	59775665	missense	probably damaging	1.00
R7296:Epha6	UTSW	16	59915838	missense	probably benign	0.00
R7343:Epha6	UTSW	16	59960430	missense	probably damaging	0.98
R7443:Epha6	UTSW	16	59775625	missense	possibly damaging	0.93
R7533:Epha6	UTSW	16	60205562	missense	probably damaging	1.00
R7602:Epha6	UTSW	16	59775568	missense	probably damaging	1.00
R7604:Epha6	UTSW	16	60205772	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGGAAATTACCGTCATTCTCCAC -3'
(R):5'- ACATGTCGGATTCCTTTGTAACTC -3'

Sequencing Primer
(F):5'- GTCATTCTCCACAGAAAATTCATGC -3'
(R):5'- CCATGTCCCTTTATGAACTCAAAAAG -3'

Posted On

2016-12-15