Incidental Mutation 'R5775:Epha6'
ID448755
Institutional Source Beutler Lab
Gene Symbol Epha6
Ensembl Gene ENSMUSG00000055540
Gene NameEph receptor A6
Synonymsm-ehk2, Hek12, Ehk2
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5775 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59653483-60605531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59818994 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 839 (R839Q)
Ref Sequence ENSEMBL: ENSMUSP00000066734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068860] [ENSMUST00000161358]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068860
AA Change: R839Q

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: R839Q

DomainStartEndE-ValueType
low complexity region 4 37 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
EPH_lbd 128 301 5.95e-125 SMART
Pfam:GCC2_GCC3 361 406 1.6e-8 PFAM
FN3 426 518 5.83e-3 SMART
FN3 537 618 2.19e-7 SMART
Pfam:EphA2_TM 644 722 1.8e-22 PFAM
TyrKc 725 1024 3.66e-122 SMART
SAM 1052 1119 1.24e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161358
SMART Domains Protein: ENSMUSP00000124340
Gene: ENSMUSG00000055540

DomainStartEndE-ValueType
Pfam:EphA2_TM 9 88 1.2e-26 PFAM
Pfam:Pkinase_Tyr 91 183 3e-18 PFAM
Pfam:Pkinase 91 296 1.5e-29 PFAM
Pfam:Pkinase_Tyr 179 295 6e-31 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Epha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Epha6 APN 16 59915962 missense probably damaging 1.00
IGL00849:Epha6 APN 16 60425111 missense possibly damaging 0.89
IGL00898:Epha6 APN 16 59775541 critical splice donor site probably null
IGL01353:Epha6 APN 16 60424895 missense probably damaging 1.00
IGL01409:Epha6 APN 16 59655737 nonsense probably null
IGL01577:Epha6 APN 16 59956926 missense possibly damaging 0.57
IGL01653:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01654:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01655:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01657:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01663:Epha6 APN 16 59775644 missense probably damaging 1.00
IGL01899:Epha6 APN 16 59839303 missense probably benign 0.05
IGL02272:Epha6 APN 16 59818937 missense probably damaging 1.00
IGL03265:Epha6 APN 16 60060231 splice site probably benign
IGL03333:Epha6 APN 16 59682688 missense probably damaging 1.00
rauwulfia UTSW 16 59682616 missense probably damaging 1.00
PIT4377001:Epha6 UTSW 16 60205552 missense probably damaging 0.98
R0505:Epha6 UTSW 16 60205732 missense possibly damaging 0.89
R1593:Epha6 UTSW 16 60424904 missense probably damaging 1.00
R1764:Epha6 UTSW 16 59775728 missense probably null 1.00
R1836:Epha6 UTSW 16 60205745 missense probably damaging 1.00
R2061:Epha6 UTSW 16 59655797 missense probably damaging 1.00
R2125:Epha6 UTSW 16 59682688 missense probably damaging 1.00
R2867:Epha6 UTSW 16 59960296 intron probably null
R2867:Epha6 UTSW 16 59960296 intron probably null
R3760:Epha6 UTSW 16 60220984 missense possibly damaging 0.70
R4305:Epha6 UTSW 16 60526520 splice site probably null
R4613:Epha6 UTSW 16 59666597 missense possibly damaging 0.80
R4818:Epha6 UTSW 16 59654063 missense probably damaging 0.99
R4832:Epha6 UTSW 16 59960413 missense probably damaging 0.98
R4895:Epha6 UTSW 16 59666555 missense probably benign 0.08
R5014:Epha6 UTSW 16 59666579 missense probably benign 0.00
R5316:Epha6 UTSW 16 59954720 missense probably damaging 0.99
R5403:Epha6 UTSW 16 59775570 missense probably damaging 1.00
R5417:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5418:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5678:Epha6 UTSW 16 59818979 missense probably damaging 1.00
R5808:Epha6 UTSW 16 59682742 missense probably damaging 1.00
R6076:Epha6 UTSW 16 60205710 missense probably damaging 1.00
R6146:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6212:Epha6 UTSW 16 60425356 missense possibly damaging 0.77
R6242:Epha6 UTSW 16 59682662 missense probably damaging 1.00
R6503:Epha6 UTSW 16 60205621 missense possibly damaging 0.61
R6580:Epha6 UTSW 16 59682616 missense probably damaging 1.00
R6726:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6728:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6798:Epha6 UTSW 16 60605064 missense possibly damaging 0.53
R6798:Epha6 UTSW 16 60605065 missense possibly damaging 0.53
R6903:Epha6 UTSW 16 60526462 missense probably benign 0.00
R6999:Epha6 UTSW 16 60425170 missense possibly damaging 0.94
R7058:Epha6 UTSW 16 59682650 missense probably damaging 1.00
R7109:Epha6 UTSW 16 59682668 missense probably damaging 1.00
R7263:Epha6 UTSW 16 59775665 missense probably damaging 1.00
R7296:Epha6 UTSW 16 59915838 missense probably benign 0.00
R7343:Epha6 UTSW 16 59960430 missense probably damaging 0.98
R7443:Epha6 UTSW 16 59775625 missense possibly damaging 0.93
R7533:Epha6 UTSW 16 60205562 missense probably damaging 1.00
R7602:Epha6 UTSW 16 59775568 missense probably damaging 1.00
R7604:Epha6 UTSW 16 60205772 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGGAAATTACCGTCATTCTCCAC -3'
(R):5'- ACATGTCGGATTCCTTTGTAACTC -3'

Sequencing Primer
(F):5'- GTCATTCTCCACAGAAAATTCATGC -3'
(R):5'- CCATGTCCCTTTATGAACTCAAAAAG -3'
Posted On2016-12-15